Overview

Brief Summary

Introduction

Gonatus, the most speciose genus in the family, has its highest diversity in the high North Pacific. These squids reach a maximum length of 39 cm ML.

Diagnosis

A gonatid ...

  • with one or more hooks in median line on tentacular club.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Characteristics

  1. Arms
    1. Hooks in two medial series on arms I-III.

  2. Tentacles
    1. Tentacles present in subadults.
    2. Tentacular club with one or more hooks in median line; one greatly enlarged.
    3. Proximal locking-apparatus of club with suckers and knobs medial to 4-6 large ridges and grooves, and usually several smaller ones.

      Figure. Oral view of tentacular club of G. californiensis, 315 mm GL, immature female, preserved. Photograph of preserved club by R. Young.

  3. Head
    1. Radula with 5 teeth in transverse row.

  4. Mantle
    1. Mantle tissue muscular or flabby depending on species.

  5. Fins
    1. Fins sagittate, drawn out posteriorly into a short tail.

  6. Photophores
    1. Ocular photophores present only in G. pyros.

Comments

Many of the species characteristics are found on the tentacles. The tentacles are complex and for descriptive purposes the club and stalk are divided into various zones, regions and series as follows:


Figure. Oral view of the club and distal stalk of G. californiensis showing the terminology (much of it color coded) used in describing the tentacle. Drawing modified from Young (1972).

The following table compares some characteristics of subadult species of Gonatus. The most useful character states are indicated in bold-red. The table doesn't separate all species.

Species / Character Habitat Ocular light organs Proximal club hooks Distal club hook Medial suckers of tentacular stalk Suckers on club Club suckers of dorsal- and ventral marginal zones merge proximally. Arm II< III length Club length
G. antarcticus Antarctic waters No Yes Yes
120-140 250-315 No 40-50% ML
16-17% ML
G. berryi North Pacific No Yes Yes 0-2 159-181 No 60-70% GL 30-37% GL
G. californiensis North Pacific
No Yes Yes 40-80 215-270 No 46-53% GL 17-24% GL
G. fabricii North Atlantic No Yes Yes 38-109 155-229 No 53-59% GL 12-20% GL
G. madokai North Pacific
No Yes Yes Many ? Yes 90% ML 20% ML
G. middendorffi North Pacific
No No Yes Few ? No 50% ML
10% ML
G. onyx North Pacific
No No No 0-27 160-200 No 48-54% GL
20-25% GL
G. oregonensis North Pacific
No Yes Yes 70 295-370 No 59-63% ML
21-30% ML
G. pyros North Pacific
Yes Yes Yes 50-125 151-184 No 60-70% GL 20-25% GL
G. steenstrupi North Atlantic
No Yes Yes 75-165 190-225 No 50-70% GL
20-36% GL
G. ursabrunae* North Pacific
No ? ? ? ? ? 42-56% ML 13-25% ML

*Known only from juveniles but with distinctive relative sucker sizes on arms and club dactylus.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 440 specimens in 12 taxa.
Water temperature and chemistry ranges based on 391 samples.

Environmental ranges
  Depth range (m): 5 - 3458.5
  Temperature range (°C): -0.326 - 13.742
  Nitrate (umol/L): 6.420 - 44.622
  Salinity (PPS): 33.221 - 35.328
  Oxygen (ml/l): 0.303 - 7.241
  Phosphate (umol/l): 0.575 - 3.500
  Silicate (umol/l): 3.399 - 172.531

Graphical representation

Depth range (m): 5 - 3458.5

Temperature range (°C): -0.326 - 13.742

Nitrate (umol/L): 6.420 - 44.622

Salinity (PPS): 33.221 - 35.328

Oxygen (ml/l): 0.303 - 7.241

Phosphate (umol/l): 0.575 - 3.500

Silicate (umol/l): 3.399 - 172.531
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Life History


Brooding of egg masses in G. onyx (Seibel et al., 2000) [suspected in G. fabricii (Bjorke et al., 1997)] occurs in deep water. Such brooding behavior, rare in oceanic squids, may prove to be characteristic of all members of the genus and perhaps the entire family. The long brooding period demanded by cold temperatures in deep water and its resulting slow population turnover rate, presumably is offset, in evolutionary time, by low egg mortality in the vast, dark, lowly populated bathypelagic environment (see Seibel, et al., 2000). For more information on brooding behavior, go to the G. onyx page.


Figure. Side view of Gonatus onyx brooding an egg mass at 2522 m depth off California in Monterey Canyon. ROV photograph from Seibel et al. (2005). © 2002 MBARI

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gonatus cf. onyx OK-2005

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATCTTTGGTATTTGAGCAGGTCTTCTAGGAACCTCCCTAAGCCTAATAATTCGAACTGAATTAGGTCAACCTGGCTCTCTACTAAACGAT---GATCAACTCTACAATGTTGTAGTTACAGCCCATGGATTTATCATAATTTTTTTTTTAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTTCCCTTAATACTAGGAGCCCCAGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGATTACTTCCTCCTTCCTTGACACTATTATTAGCTTCCTCAGCAGTTGAAAGAGGGGCAGGGACAGGATGAACCGTTTATCCCCCTCTTTCTAGTAATTTATCTCATGCAGGCCCTTCAGTTGATTTAGCCATTTTTTCTTTACATTTAGCTGGAGTTTCCTCTATTCTAGGAGCCATTAATTTCATTACTACAATTTTAAATATGCGATGAGAAGGGCTACAAATAGAACGGCTACCCTTATTTGCTTGATCTGTATTTATTACTGCAATTTTACTACTTCTATCTCTTCCTGTTCTTGCTGGAGCGATTACTATATTATTAACTGACCGAAATTTTAACACAACTTTTTTTGACCCAAGGGGAGGGGGGGATCCTATCTTGTACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gonatus cf. onyx OK-2005

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:103Public Records:25
Specimens with Sequences:82Public Species:10
Specimens with Barcodes:82Public BINs:8
Species:13         
Species With Barcodes:11         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Gonatus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gonatus

Gonatus is a genus of squid in the family Gonatidae, comprising twelve species, and therefore containing the most species in the family. Adult squid belonging to species in this genus are notable for their lack of tentacles.[1]

Species

Species nameYear describedMantle length[2]
Gonatus antarcticus1898230 mm
Gonatus berryi1923240 mm
Gonatus californiensis1972315 mm
Gonatus fabricii1818129 mm
Gonatus kamtschaticus1849300 mm
Gonatus madokai1977329 mm
Gonatus middendorffi1981225 mm
Gonatus onyx1972145 mm
Gonatus oregonensis1985Young squid- 46 mm
Gonatus pyros1972160 mm
Gonatus steenstrupi198194 mm
Gonatus ursabrunae1985Young squid- 25 mm

References

  1. ^ Diversity, distribution and ecology of gonatid squids in the subarctic Pacific: A review. K. Jefferts, 1983.
  2. ^ Tree of Life web project
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!