Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:67Public Records:33
Specimens with Sequences:55Public Species:5
Specimens with Barcodes:54Public BINs:5
Species:9         
Species With Barcodes:8         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trigonospila sp. 4

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Trigonospila Janzen03

The following is a representative barcode sequence, the centroid of all available sequences for this species.


No available public DNA sequences.

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trigonospila Janzen03

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 14
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trigonospila Janzen32

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Trigonospila Wood02

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTCATTTTTGGAGCTTGATCAGGATTAATTGGAACTTCTTTAAGAATTTTAATTCGAACAGAATTAGGACATCCAGGAGCATTAATTGGTGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCCTTTCCACGAATAAATAATATAAGTTTTTGATTACTACCACCTGCTTTAACTTTATTACTGATTAGAAGAATAGTAGAAAACGGGGCTGGTACAGGTTGAACTGTTTACCCTCCACTATCTTCTAATTTAGCTCATGGAGGTTCTTCAGTAGATTTAACAATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAGTAAATTTTATTACAACAGTAATTAATATACGAGCCACAGGAATTTCATTTGATCGAATACCCCTTTTTGTTTGATCTGTAGTAATTACTGCTTTGTTACTTCTTTTATCATTACCTGTTTTAGCAGGAGCTATTACAATACTATTAACTGACCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trigonospila Wood02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Trigonospila Wood01

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAGCTTGATCAGGAATAATTGGAACTTCTTTAAGAATTTTAATTCGTACAGAATTAGGACATCCAGGAGCATTAATTGGTGATGATCAAATTTATAATGTAATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGTTTTGGAAATTGATTAATTCCATTAATATTAGGAGCCCCAGATATAGCCTTTCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCTGCTTTAACTTTATTACTAGTTGGAAGAATAGTAGAAAACGGAGCTGGTACAGGTTGAACTGTTTACCCTCCTTTATCTTCTAATTTAGCTCATGGAGGATCCTCAGTGGATTTAACAATTTTCTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGTGCAGTAAATTTTATTACAACAGTAATTAATATACGAGCTACAGGAATTTCATTTGATCGAATACCACTTTTTGTTTGATCAGTAGTAATTACTGCTTTATTACTTCTTTTATCTTTACCAGTTTTAGCAGGAGCAATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trigonospila Wood01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Trigonospila

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Trigonospila

'Trigonospila' is a small genus of true flies in the family Tachinidae.[2][3] Like all tachinid flies, Trigonospila are parasitoids of other arthropods, however host records are sparse for all Trigonospila species.[3]

Distribution[edit]

The genus has a worldwide distribution, but is particularly common in Australia. In Australia, T. brevifacies and T. cingulata are common within their respective ranges and can often be found resting on vegetation. They have been reported in some environments to be the most common conspicuous fly species.[4] In Australia, Trigonospila have been collected in all mainland states and territories, Tasmania, and some large offshore islands including Kangaroo Island in South Australia, and Brampton Island in Queensland.

Identification[edit]

Trigonospila are strikingly patterned flies; primarily black with pearly whitish to golden transverse bars on the thorax and abdomen. There are two whitish bars on the thorax; one adjacent to the transverse suture, and the second adjacent to the scutellum. There may also be a white triangle on the tip of the scutellum, and the subscutellum is usually white. Abdominal colouration varies between species however it is typical that there are three whitish bars on the abdomen; one at the anterior margin of each the third, fourth, and fifth abdominal tergites. The width of these bars differs between species.[4]

Biocontrol applications[edit]

T. brevifacies is a polyphagous parasitoid of the larvae of Lepidoptera and is native to the eastern states of Australia with a range extending from Tasmania to southern Queensland and possibly as far west as South Australia. T. brevifacies has been deployed in New Zealand as a biocontrol agent of a number of agricultural pests including the light brown apple moth Epiphyas postvittana (Lepidoptera : Tortricidae) and the potato tuber moth Phthorimaea operculella (Lepidoptera : Gelechiidae).[3]

T. cingulata and T. fasciata are believed to be parasitoids of chrysomelid beetles in the genus Paropsis,[3] some of which may be pests of agriculture or forestry.

Species[edit]

References[edit]

  1. ^ James E. O'Hara (December 31, 2008). "World Genera of the Tachinidae (Diptera) and their Regional Occurrence" (PDF). Version 4.0. University of Guelph. Retrieved August 1, 2010. 
  2. ^ James E. O'Hara, Hiroshi Shima, & Chuntian Zhang. "Annotated Catalogue of the Tachinidae (Insecta: Diptera) of China." Zootaxa 2190 (2009): 1-236.
  3. ^ a b c d Crosskey RW (1973) A conspectus of the Tachinidae (Diptera) of Australia, including keys to the supraspecific taxa and taxonomic and host catalogues. Bulletin of the British Museum (Natural History) Supp. 21, London.
  4. ^ a b Hardy GH (1934) Notes on Australian Muscoidea (Calyptrata). Proceedings of the Royal Society of Queensland 45: 30-37.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!