Overview

Comprehensive Description

General Description

The only other species with an orange collar on the thorax and metallic blue abdomen is Cisseps fulvicollis, which has markedly narrower wings and is smaller.
Royal Alberta Museum page
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Primarily a species of eastern North America, this species has apparently expanded its range westward in the last fifty years, since it was not recorded by Bowman (1951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Found throughout open, grassy habitats in the aspen parkland and boreal region.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Grasses and sedges.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Flowering Plants Visited by Ctenucha virginica in Illinois

Ctenucha virginica Esper: Ctenuchidae, Lepidoptera
(this observation is from Stevenson; this moth is the Virginia Ctenucha; sometimes this species is assigned to the Arctiidae)

Bignoniaceae: Catalpa speciosa sn (St)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Mid June to early July.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ctenucha virginica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 20 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNAACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGTACTTCCCTTAGATTATTAATCCGAGCTGAATTAGGTACTCCCGGATCTTTAATTGGTGATGATCAAATTTATAATACCATTGTTACAGCACATGCTTTTATTATAATTTTCTTCATGGTTATACCAATCATAATTGGAGGATTTGGTAATTGATTAGTACCCTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCCCCCTCTCTTACCTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGCTCATGGAGGAAGATCAGTAGATTTAGCCATTTTCTCTCTTCATTTAGCAGGAATTTCATCAATTTTAGGTGCAATTAACTTTATTACTACAATTATTAATATACGATTAAATAACTTATCTTTCGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTTTTATTACTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACAATACTCTTAACTGATCGAAACCTAAATACATCATTTTTTGATCCTGCGGGAGGAGGAGACCCTATTCTTTATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ctenucha virginica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 67
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Widespread and common.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ctenucha virginica

The Virginia Ctenucha (Ctenucha virginica) is a moth of the Arctiidae family. It is endemic to eastern North America, but has expanded its range westward. It inhabits wet meadows and open spaces with bushes from North Carolina to Canada east of the Rocky Mountains.

The wingspan ranges from 30–50 millimetres (1.2–2.0 in). The wing color varies from black to olive-brown. The body is a metallic blue-green. The head is yellow-orange, with feathery antennae. The caterpillar (about 20–25 mm) has multiple tufts of white and yellow hair. It feeds mostly on grasses and undergoes metamorphosis in May–August. Adults feed primarily on nectar in daylight.

The larvae feed on various grasses, irises, and sedges.

Similar species[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Following Lafontaine and Schmidt (2010), the traditional Arctiidae have been transferred to the family Erebidae as a subfamily (Arctiinae), with former subfamilies such as Lithosiinae now treated as tribes. The circumscription of Arctiinae remains virtually identical to recent circumscriptions of Arctiidae, but circumscriptions of some taxa within the Arctiinae have changed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!