Molecular Biology and Genetics
Molecular Biology
Barcode data: Euclystis recurva
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGTACTTCATTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCACGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTCTGACTTCTTCCCCCTTCTTTAACTCTTCTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTATCCTCCTCTTTCCTCTAATATTGCCCATAGAGGTAGATCTGTAGATCTAGCAATTTTTTCCCTCCACTTAGCGGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTGAACAATTTAATATTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCTTTTTTATTATTATTATCTTTACCTGTTTTAGCAGGAGCTATTACCATACTTCTTACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGGGGTGACCCAATTTTATATCAACACTTATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Euclystis recurva
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 3
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
