Articles on this page are available in 1 other language: Arabic (10) (learn more)

Overview

Comprehensive Description

General Description

A medium-size (3.0-3.5 cm. wingspan) moth with pale grey (sometimes with a pinkbrown tint) forewings and dark hindwings. The forewing pattern is unusual and unmistakable. A wide, dirty white swath runs in an arc from the wing base along the leading edge to about mid-wing, with the area below this grey-brown. The outer half of the forewing has a series of narrow wavy bands of black, dark grey-brown, and brown shading into a broad subterminal pale grey band and a narrow blackish terminal band followed by fine pale and dark grey bands. Hindwings are dark smoky brown, faintly banded and slightly darkening toward the outer margin. The antennae are simple, and both the sexes are similar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

From Newfoundland west across the southern boreal forest to central and northern Alberta, south to Maryland, Kentucky and North Carolina. In Alberta, it has been collected in the Boreal forest in the eastern half of the province, from the Edmonton area north to Lake Athabasca.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Sandy jackpine forest and other well-drained boreal woodlands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

No Alberta data. Elsewhere, the larvae are reported to feed on Blueberry (Vaccinium sp.) and Huckleberry (Gaylussacia sp.), both in the family, Ericaceae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults are on the wing in Alberta in July and early August.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

The adults are nocturnal and come to light. There is a single brood each year
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chrysanympha formosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTTGGTACATCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTATTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTCTCCCCCCGTCATTAACTTTATTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATACCCCCCTCTTTCATCTAATATTGCTCATGGTGGAAGTTCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATCAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTTGGTATTACAGCTTTTTTATTATTACTTTCTTTACCTGTTTTAGCAGGAGCAATTACTATACTTTTAACAGATCGTAATTTAAATACCTCTTTTTTTGACCCTGCTGGAGGGGGAGATCCTATCTTATACCAACATTTATNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chrysanympha formosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 20
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

At the western edge of the range in Alberta. No concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Chrysanympha formosa

The Formosa Looper (Chrysanympha formosa) is a moth of the Noctuidae family. It is found from Newfoundland west to Manitoba and south to the mountains of North Carolina and Tennessee.

The wingspan is 30-35 mm. Adults are on wing from July to August in Alberta and from June to August in the Great Smoky Mountains National Park. There is one generation per year.

The larvae have been recorded on Gaylussacia dumosa and Vaccinium species.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!