Overview

Brief Summary

The mosquito genus Anopheles contains about 460 recognized species, many of which have serious impacts on human health, as they serve as vectors for transmitting malaria and other disease pathogens, including canine heartworm Dirofilaria immitis, the Filariidae Wuchereria bancrofti and Brugia malayi, and viruses such as one that causes O'nyong'nyong fever. Female mosquitos usually require a blood meal for the development of eggs but will also feed on sugar sources for energy. Males only feed on nectar and sugar sources. One important behavioral factor in transmission of malaria is the degree to which an Anopheles species prefers to feed on humans (anthropophily) or animals such as cattle (zoophily). Anthropophilic Anopheles such A. gambiae and A. funestus, (the primary malaria vectors in Africa) are the most likely to transmit malaria vectors among people. The mosquito must also live long enough to incubate the malaria parasite long enough for it to develop its infectiousness (usually 10-21 days). Although malaria is nowadays limited to tropical areas, and especially sub-Saharan Africa, many Anopheles species live in colder latitudes. The CDC warns that it is possible to re-introduce malaria into areas where it has been eliminated (Europe, North America, the Caribbean and parts of Asia and southern Central America). In 2007 the Gates foundation reignited the strategy of world-wide malaria eradication, among the important organizations involved in controlling this disease. Understanding the biology and behavior of Anopheles mosquitoes is crucial in understanding how malaria is transmitted and will aid in designing appropriate control strategies. ( Wikipedia 2011)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Associations

Known prey organisms

Anopheles (Anopheles sp.) preys on:
detritus
dissolved organic matter

Based on studies in:
Finland (Lake or pond, Rockpool)
England (Plant substrate, Treeholes)

This list may not be complete but is based on published studies.
  • P. Ohm and H. Remmert, Etudes sur les rockpools des Pyrenees-Orientales, Vie et Milieu 6:194-209, from p. 208 (Fig. 4.) (1955).
  • R. L. Kitching, 1983. Community structure in water-filled treeholes in Europe and Australia -- comparisons and speculations. In: Phytotelmata: Terrestrial Plants as Hosts for Aquatic Insect Communities, J. H. Frank and L. P. Lounibos, Eds. (Plexus Pub
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Anopheles (Anopheles sp.) is prey of:
Meladema
Graptodytes
Notonecta
Bidessus

Based on studies in:
Finland (Lake or pond, Rockpool)

This list may not be complete but is based on published studies.
  • P. Ohm and H. Remmert, Etudes sur les rockpools des Pyrenees-Orientales, Vie et Milieu 6:194-209, from p. 208 (Fig. 4.) (1955).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Anopheles sp. KHH9

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 52
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH4

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 48
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH8

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH5

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 84
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH6

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH7

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 290
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles sp. KHH1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 309
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles nr. gabaldoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles eiseni2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-06

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-07

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI29

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI25

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-21

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-10

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-34

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-20

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-24

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-36

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-35

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-11

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-12

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-13

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-17

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-14

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-38

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-28

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-09

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-30

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-15

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-26

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-16

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-05

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-19

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-02

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles MBI-01

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Anopheles longirostris C1 NWB-2009

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAAGTTTTTGAATACTACCTCCTTCTTTAACTCTTTTAATTTCTAGAAGTATAGTAGAAAATGGGGCTGGAACTGGATGAACAGTTTACCCCCCATTATCTTCTGGTATTGCTCATGCTGGAGCTTCCGTTGATTTA---GCAATTTTTTCTTTACATTTAGCGGGGATTTCCTCAATTTTAGGAGCAGTAAATTTTATTACTACTGTGATTAATATACGATCTCCAGGAATTACTTTAGACCGAATACCTTTATTTGTTTGATCTGTAGTAATTACTGCAATTTTATTACTTTTATCCCTACCTGTATTAGCAGGA---GCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTCTTTGACCCGGCGGGGGGAGGAGATCCCATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCTGGGTTTGGAATAATTTCTCATATTATTACTCAAGAAAGAGGTAAAAAG---GAAACATTTGGAAACTTAGGAATA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles longirostris C1 NWB-2009

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Anopheles longirostris C2 NWB-2009

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATAAGTTTTTGAATACTACCTCCTTCTTTAACTCTTTTAATTTCTAGAAGTATAGTAGAAAATGGAGCTGGAACTGGATGAACAGTTTACCCTCCTTTATCTTCCGGGATTGCTCATGCTGGGGCTTCCGTTGATTTA---GCAATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCAGTAAATTTTATTACTACTGTAATTAATATACGATCTCCAGGAATTACTTTAGACCGAATACCTTTATTTGTTTGATCTGTAGTAATTACTGCAATTTTATTACTTTTATCCTTACCGGTATTAGCAGGA---GCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTCTTTGATCCAGCGGGTGGAGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCTGAAGTTTATATTTTAATTTTACCCGGATTTGGTATAATTTCTCATATTATTACTCAAGAAAGAGGTAAAAAG---GAAACATTTGGAAACTTAGGAATA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Anopheles longirostris C2 NWB-2009

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 14181
Specimens with Sequences: 11156
Specimens with Barcodes: 9122
Species: 459
Species With Barcodes: 365
Public Records: 5187
Public Species: 181
Public BINs: 153
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Taxonomy of Anopheles

Anopheles is a genus of mosquitoes (Culicidae). Of about 484 recognised species, over 100 can transmit human malaria, but only 30–40 commonly transmit parasites of the genus Plasmodium that cause malaria, which affects humans in endemic areas. Anopheles gambiae is one of the best known, because of its predominant role in the transmission of the deadly species Plasmodium falciparum.

Classification[edit source | edit]

Range map of selected Anopheles species

The classification of this genus began in 1901 with Theobald. Despite the passage of time, the taxonomy remains incompletely settled.[1][2][3] Classification into species is based on morphological characteristics - wing spots, head anatomy, larval and pupal anatomy, and chromosome structure, and more recently on DNA sequences.[4][5][6][7]

The genus Anopheles belongs to a subfamily Anophelinae with three genera: Anopheles Meigen (nearly worldwide distribution), Bironella Theobald (Australia only: 11 described species) and Chagasia Cruz (Neotropics: four described species). The genus Bironella has been divided into three subgenera: Bironella Theobald (two species), Brugella Edwards (three species) and Neobironella Tenorio (three species). Bironella appears to be the sister taxon to the Anopheles, with Chagasia forming the outgroup in this subfamily.

The type species of the genus is Anopheles maculipennis Meigen 1818.

Subgenera[edit source | edit]

The genus has been subdivided into seven subgenera based primarily on the number and positions of specialized setae on the gonocoxites of the male genitalia. The system of subgenera originated with the work of Christophers, who in 1915 described three subgenera: Anopheles (widely distributed), Myzomyia (later renamed Cellia) (Old World) and Nyssorhynchus (Neotropical). Nyssorhynchus was first described as Lavernia by Theobald. Edwards in 1932 added the subgenus Stethomyia (Neotropical distribution). Kerteszia was also described by Edwards in 1932, but then was recognised as a subgrouping of Nyssorhynchus. It was elevated to subgenus status by Komp in 1937; this subgenus is also found in the Neotropics. Two additional subgenera have since been recognised: Baimaia (Southeast Asia only) by Harbach et al. in 2005 and Lophopodomyia (Neotropical) by Antunes in 1937.

One species within each subgenus has been identified as the type species of that particular subgenus:

Within the genus Anopheles are two main groupings, one formed by the Cellia and Anopheles subgenera and a second by Kerteszia, Lophopodomyia, and Nyssorhynchus. Subgenus Stethomyia is an outlier with respect to these two taxa. Within the second group, Kerteszia and Nyssorhynchus appear to be sister taxa. Cellia appears to be more closely related to the Kerteszia-Lophopodomyia-Nyssorhynchus group than to Anopheles or Stethomyia, tentatively suggesting the following branching order: ( Stethomyia ( Anopheles ( Cellia ( Lophopodomyia ( Kerteszia, Nyssorhynchus))))).

The number of species currently recognised within the subgenera is given here in parentheses: Anopheles (206 species), Baimaia (one), Cellia (239), Kerteszia (12), Lophopodomyia (six), Nyssorhynchus (34) and Stethomyia (fuve).

The subgenus Baimaia may be elevated to genus level, as it appears to be a sister group to Bironella and all other Anopheles.[8]

The ancestors of Drosophila and Anopheles diverged 260 million years ago.[9] The Old and New World Anopheles species subsequently diverged between 80 and 95 million years ago.[9][10]

Divisions below subgenus[edit source | edit]

Taxonomic units between subgenus and species are not currently recognised as official zoological names. In practice, a number of taxonomic levels have been introduced. The larger subgenera (Anopheles, Cellia, and Nyssorhynchus) have been subdivided into sections and series, which in turn have been divided into groups and subgroups. Below subgroup but above species level is the species complex. Taxonomic levels above species complex can be distinguished on morphological grounds. Species within a species complex are either morphologically identical or extremely similar and can only be reliably separated by microscopic examination of the chromosomes or DNA sequencing. The classification continues to be revised.

The first species complex was described in 1926 when the problem of nontransmission of malaria by Anopheles gambiae was solved by Falleroni, who recognised that An. gambiae was a complex of six species, of which only four could transmit malaria. This complex has subsequently been revised to a total of seven species of which five transmit malaria.

Subgenus Nyssorhynchus has been divided in three sections: Albimanus (19 species), Argyritarsis (11 species) and Myzorhynchella (four species). The Argyritarsis section has been subdivided into Albitarsis and Argyritarsis groups.

The Anopheles group was divided by Edwards into four series: Anopheles (worldwide), Myzorhynchus (Palearctic, Oriental, Australasian and Afrotropical), Cycloleppteron (Neotropical) and Lophoscelomyia (Oriental); and two groups, Arribalzagia (Neotropical) and Christya (Afrotropical). Reid and Knight (1961) modified this classification by subdividing the subgenus Anopheles into two sections, Angusticorn and Laticorn and six series. The division was based on the shape of their pupal trumpets. The Laticorn section was created for those species with wide, funnel-shaped trumpets having the longest axis transverse to the stem, and the Angusticorn section for species with semitubular trumpets having the longest axis vertical more or less in line with the stem. The earlier Arribalzagia and Christya groups were considered to be series. The Angusticorn section includes members of the Anopheles, Cycloleppteron, and Lophoscelomyia series, and the Laticorn section includes the Arribalzagia (24 species), Christya, and Myzorhynchus series.

Cellia is the largest subgenus: all species within this subgenus are found in the Old World. It has been divided into six series - Cellia (eight species), Myzomyia (69 species), Neocellia (33 species), Neomyzomyia (99 species), Paramyzomyia (six species) and Pyretophorus (22 species). This classification was developed by Grjebine (in 1966), Reid (in 1968) and Gillies & de Meillon (also in 1968) based on the work by Edwards in 1932. Series definition within this subgenus is based on the cibarial armature - a collection of specialized spicules borne ventrally at the posterior margin of the cibarium - which was first used as a taxonomic method by Christophers in 1933.

Kerteszia is a small subgenus found in South America whose larvae have specific ecological requirements; these can only delevop within water that accumulates at the base of the follicular axis of the epiphytic Bromeliaceae. Unlike the majority of mosquitoes, species in this subgenus are active during the day.

Within a number of species, separate subspecies have been identified. The diagnostic criteria and characteristic features of each subgenus are discussed on the own page.

Species complexes[edit source | edit]

Anopheles nuneztovari is a species complex with at least one occurring in Colombia and Venezuela and the another occurring in the Amazon Basin.[11] These clades appear to have diverged and expanded in the Pleistocene.

Medical and veterinary importance[edit source | edit]

The first demonstration that mosquitoes could act as vectors of disease was by Patrick Manson, a British physician working in China, who showed that a Culex species could transmit filariasis in 1878. This was then followed in 1897 by Ronald Ross, who showed avian malaria could also be transmitted by a species of Culex. Grassi in Italy showed that the species causing human malaria were transmitted by species of the genus Anopheles in 1898. Anopheles gambiae (then Anopheles coastalis), the most important of the vectors transmitting human malaria, was first recognised as such in 1899 at Freetown, Sierra Leone.[12] It was later realised that only a small number of species of mosquitoes were responsible for the vast majority of human malaria and other diseases. This generated a considerable interest in the taxonomy of this and other mosquito genera.

The species of the subgenera Baimaia, Lophopodomyia, and Stethomyia are not of medical importance.

All species within the subgenus Anopheles known to carry human malaria lie within either the Myzorhynchus or the Anopheles series. Anopheles maculipennis s.l. is a known vector of West Nile virus.

Six species in the subgenus Kerteszia can carry human malaria. Of these, only An. bellator and An. cruzii are of importance. Anopheles bellator can also transmit Wuchereria bancrofti.

Several species of the subgenus Nyssorhynchus are of medical importance.

All series of the subgenus Cellia contain vectors of malarial protozoa and microfilariae.

Five species of anopheline mosquitoes (An. arabiensis, An. funestus, An. gambiae, An. moucheti, An. nili) all belonging to the subgenus Cellia are responsible for over 95% of total malaria transmission for Plasmodium falciparum in continental sub-Saharan Africa.

Anopheles sundaicus and An. subpictus are important vectors of Plasmodium vivax.


Species evolution[edit source | edit]

The Anopheles gambiae complex has a number of important malaria vectors. A chromosomal study suggests that An. merus is the basal member of this complex and is sister species to An. gambiae.[13] The two species An. quadriannulatus A and An. quadriannulatus B - neither of whom are vectors for malaria - are derived from An. gambiae.

Species listing[edit source | edit]

Species that have been shown to be vectors of human malaria are marked with a star (*) after the name.

Subgenus Anopheles[edit source | edit]

Anopheles anthropophagus* Xu & Feng 1975
Anopheles confusa Bonne-Wepster 1951
Anopheles derooki Soesilo & Van Slooten 1931
Anopheles gracilis Theobald 1905
Anopheles hollandi Taylor 1934
Anopheles obscura Tenorio 1975
Anopheles papuae Swellengrebel & Swellengrebel de Graaf 1919
Anopheles simmondsi Tenorio 1977
Anopheles travestita Brug 1928
Section Angusticorn
Series Anopheles
Anopheles algeriensis Theobald 1903
Anopheles concolor Edwards 1938
Anopheles marteri Senevet & Prunnelle 1927
subspecies marteri
subspecies sogdianus Keshishian
Complex Claviger (Coluzzi et al. 1965)
Anopheles claviger* Meigen 1804
Anopheles petragnani Del Vecchio 1939
Group Aitkenii (Reid & Knight, 1961)
Anopheles aberrans Harrison & Scanlon 1975
Anopheles acaci Baisas 1946
Anopheles aitkenii James 1903
Anopheles bengalensis Puri 1930
Anopheles borneensis McArthur 1949
Anopheles fragilis Theobald 1903
Anopheles insulaeflorum Swellengrebel & Swellengrebel de Graaf 1919
Anopheles palmatus Rodenwaldt 1926
Anopheles peytoni Kulasekera Harrison & Amerasinghe 1989
Anopheles pilinotum Harrison & Scanlon 1974
Anopheles pinjaurensis Barraud 1932
Anopheles stricklandi Reid 1965
Anopheles tigertti Scanlon & Peyton 1967
Group Alongensis (Phan et al. 1991)
Anopheles alongensis Evenhuis 1940
Anopheles cucphuongensis Phan, Manh, Hinh & Vien 1991
Group Atratipes (Lee et al. 1987)
Anopheles atratipes Skuse 1889
Anopheles tasmaniensis Dobrowtorsky 1966
Group Culiciformis (Reid & Knight 1961)
Anopheles culiciformis Cogill 1903
Anopheles sintoni Puri 1929
Anopheles sintonoides Ho 1938
Group Lindesayi (Reid & Knight 1961)
Anopheles mengalengensis Ma 1981
Anopheles nilgiricus Christophers 1924
Anopheles wellingtonianus Alcock 1912
Complex Gigas (Harrison et al. 1991)
Anopheles baileyi Edwards 1923
Anopheles gigas Giles 1901
subspecies crockeri Colless
subspecies danaubento Mochtar & Walandouw
subspecies formosus Ludlow
subspecies gigas Giles
subspecies oedjalikalah Nainggolan
subspecies pantjarbatu Waktoedi
subspecies refutans Alcock
subspecies simlensis James
subspecies sumatrana Swellengrebel & Rodenwaldt
Complex Lindesayi (Harrison et al. 1991)
Anopheles lindesayi Giles 1900
subspecies benguetensis King
subspecies cameronensis Edwards
subspecies japonicus Yamada
subspecies lindesayi Giles
subspecies pleccau Koidzumi
Group Maculipennis (Reid & Knight 1961)
Anopheles atropos Dyar & Knab 1906
Anopheles aztecus Hoffmann 1935
Anopheles lewisi Ludlow 1920
Anopheles walkeri Theobald 1901
Complex Quadrimaculatus (Linton 2004)
Anopheles diluvialis Reinert 1997
Anopheles inundatus Reinert 1997
Anopheles maverlius Reinert 1997
Anopheles smaragdinus Reinert 1997
Anopheles quadrimaculatus* Say 1824
Subgroup Freeborni (Linton 2004)
Anopheles earlei Vargas 1943
Anopheles freeborni* Aitken 1939
Anopheles hermsi Barr & Guptavanij 1989
Subgroup Maculipennis (Linton 2004)
Anopheles artemievi Gordeyev, Zvantsov, Goryacheva, Shaikevich & Yezhov
Anopheles atroparvus* Van Thiel 1927
Anopheles beklemishevi Stegnii & Kabanova 1976
Anopheles daciae Linton, Nicolescu & Harbach 2004
Anopheles labranchiae* Falleroni 1926
Anopheles maculipennis Meigen 1818
Anopheles martinius Shingarev 1926
Anopheles melanoon* Hackett 1934
Anopheles messeae* Falleroni 1926
Anopheles occidentalis Dyar & Knab 1906
Anopheles persiensis Linton, Sedaghat & Harbach
Anopheles sacharovi* Favre 1903
Anopheles sicaulti Roubaud 1935
Anopheles subalpinus Hackett & Lewis 1935
Group Plumbeus (Reid & Knight 1961)
Anopheles arboricola Zavortink 1970
Anopheles barberi Coquillett 1903
Anopheles barianensis James 1911
Anopheles fausti Vargas 1943
Anopheles judithae Zavortink 1969
Anopheles omorii Sakakibara 1959
Anopheles plumbeus* Stegnii & Kabanova 1828
Anopheles powderi Zavortink 1970
Anopheles xelajuensis De Leon 1938
Group Pseudopunctipennis (Reid & Knight 1961)
Anopheles chiriquiensis Komp 1936
Anopheles franciscanus McCracken 1904
Anopheles hectoris Giaquinto-Mira 1931
Anopheles tibiamaculatus Neiva 1906
Anopheles eiseni Coquillett 1902
subspecies eiseni Coquillett
subspecies geometricus Corrêa
Anopheles parapunctipennis* Martini 1932
subspecies guatemalensis de Leon
subspecies parapunctipennis Martini
Anopheles pseudopunctipennis Theobald 1901
subspecies levicastilloi Levi-Castillo
subspecies neghmei Mann
subspecies noei Mann
subspecies patersoni Alvarado & Heredia
subspecies pseudopunctipennis Theobald
subspecies rivadeneirai Levi-Castillo
Group Punctipennis (Reid & Knight 1961)
Anopheles perplexens Ludlow 1907
Anopheles punctipennis Say 1823
Complex Crucians (Wilkerson et al. 2004)
Anopheles bradleyi King 1939
Anopheles crucians Wiedemann 1828
Anopheles georgianus King 1939
Group Stigmaticus (Reid & Knight 1961)
Anopheles colledgei Marks 1956
Anopheles corethroides Theobald 1907
Anopheles papuensis Dobrowtorsky 1957
Anopheles powelli Lee 1944
Anopheles pseudostigmaticus Dobrowtorsky 1957
Anopheles stigmaticus Skuse 1889
Series Cycloleppteron (Edwards 1932)
Anopheles annulipalpis Lynch 1878
Anopheles grabhamii Theobald 1901
Series Lophoscelomyia (Edwards 1932)
Anopheles bulkleyi Causey 1937
Group Asiaticus (Reid 1968)
Anopheles annandalei Prashad 1918
Anopheles noniae Reid 1963
Subgroup Asiaticus (Rattanarithikul et al. 2004)
Anopheles asiaticus Leicester 1903
Subgroup Interruptus (Rattanarithikul et al. 2004)
Anopheles interruptus Puri 1929
Section Laticorn (Reid & Knight 1961)
Series Arribalzagia (Root 1922)
Anopheles anchietai Correa & Ramalho 1968
Anopheles apicimacula Dyar & Knab 1906
Anopheles bustamentei Galvao 1955
Anopheles calderoni Wilkerson 1991
Anopheles costai Da Fonseca & Da Silva Ramos 1939
Anopheles evandroi Da Costa Lima 1937
Anopheles fluminensis Root 1927
Anopheles forattinii Wilkerson 1999
Anopheles gabaldoni Vargas 1941
Anopheles guarao Anduze & Capdevielle 1949
Anopheles intermedius* Peryassu 1908
Anopheles maculipes Theobald 1903
Anopheles malefactor Dyar & Knab 1907
Anopheles mattogrossensis Lutz & Neiva 1911
Anopheles mediopunctatus Lutz 1903
Anopheles minor Da Costa Lima 1929
Anopheles neomaculipalpis Curry 1931
Anopheles peryassui Dyar & Knab 1908
Anopheles pseudomaculipes Peryassu 1908
Anopheles punctimacula Dyar & Knab 1906
Anopheles mediopunctatus Lutz 1903
Anopheles rachoui Galvao 1952
Anopheles shannoni Davis 1931
Anopheles veruslanei Vargas 1979
Anopheles vestitipennis Dyar & Knab 1906
Series Christya (Christophers 1924)
Anopheles implexus Theobald 1903
Anopheles okuensis Brunhes, le Goff & Geoffroy 1997
Series Myzorhynchus (Edwards 1932)
Anopheles obscurus Grunberg 1905
Anopheles bancroftii Giles 1902
Anopheles barbirostris* Van der Wulp 1884
Anopheles pollicaris Reid 1962
Group Albotaeniatus (Reid & Knight 1961)
Anopheles albotaeniatus Theobald 1903
Anopheles balerensis Mendoza 1947
Anopheles ejercitoi Mendoza 1947
Anopheles montanus Stanton & Hacker 1917
Anopheles saperoi Bohart & Ingram 1946
subspecies ohamai Ohama
subspecies saperoi Bohart & Ingram
Group Bancroftii (Reid & Knight 1961)
Anopheles pseudobarbirostris Ludlow 1935
Anopheles bancroftii Giles 1902
subspecies bancroftii Giles
subspecies barbiventris Brug
Group Barbirostris (Reid & Knight 1961)
Anopheles freyi Meng 1957
Anopheles koreicus Yamada & Watanabe 1918
Subgroup Barbirostris (Reid 1968)
Anopheles barbirostris van der Wulp 1884
Anopheles campestris Reid 1962
Anopheles donaldi Reid 1962
Anopheles franciscoi Reid 1962
Anopheles hodgkini Reid 1962
Anopheles pollicaris Reid 1962
Subgroup Vanus (Reid 1968)
Anopheles ahomi Chowdhury 1929
Anopheles barbumbrosus Strickland & Chowdhury 1927
Anopheles manalangi Mendoza 1940
Anopheles reidi Harrison 1973
Anopheles vanus Walker 1859
Group Coustani (Reid & Knight 1961)
Anopheles caliginosus De Meillon 1943
Anopheles coustani Laveran 1900
Anopheles crypticus Coetzee 1994
Anopheles fuscicolor Van Someren 1947
Anopheles namibiensis Coetzee 1984
Anopheles paludis Theobald 1900
Anopheles symesi Edwards 1928
Anopheles tenebrosus Donitz 1902
Anopheles ziemanni Grunberg 1902
Group Hyrcanus (Reid 1953)
Anopheles anthropophagus Xu and Feng 1975
Anopheles argyropus Swellengrebel 1914
Anopheles belenrae Rueda 2005
Anopheles changfus Ma 1981
Anopheles chodukini Martini 1929
Anopheles dazhaius Ma 1981
Anopheles engarensis Kanda & Oguma 1978
Anopheles hailarensis Xu JinJiang & Luo XinFu 1998
Anopheles heiheensis Ma 1981
Anopheles hyrcanus* Pallas 1771
Anopheles junlianensis Lei 1996
Anopheles kiangsuensis Xu and Feng 1975
Anopheles kleini Rueda 2005
Anopheles kummingensis Dong & Wang 1985
Anopheles kweiyangensis Yao & Wu 1944
Anopheles liangshanensis Kang Tan Cao Cheng Yang & Huang 1984
Anopheles nimpe Nguyen, Tran & Harbach
Anopheles pseudopictus Graham 1899
Anopheles pullus Yamada 1937
Anopheles sinensis* Wiedemann 1828
Anopheles sineroides Yamada 1924
Anopheles xiaokuanus Ma 1981
Anopheles xui Dong, Zhou, Dong & Mao 2007
Anopheles yatsushiroensis Miyazaki 1951
Subgroup Lesteri (Harrison 1972)
Anopheles crawfordi Reid 1953
Anopheles kiangsuensis Xu & Feng 1975
Anopheles lesteri de Meillon 1931
Anopheles paraliae Sandosham 1959
Anopheles peditaeniatus Leicester 1908
Anopheles vietnamensis Manh Hinh & Vien 1993
Subgroup Nigerrimus (Harrison 1972)
Anopheles nigerrimus* Giles 1900
Anopheles nitidus Harrison, Scanlon & Reid 1973
Anopheles pseudosinensis Baisas 1935
Anopheles pursati Laveran 1902
Group Umbrosus (Reid 1950)
Anopheles brevipalpis Roper 1914
Anopheles brevirostris Reid 1950
Anopheles hunteri Strickland 1916
Anopheles samarensis Rozeboom 1951
Anopheles similissimus Strickland & Chowdhury 1927
Subgroup Baezai (Rattanarithikul et al. 2004)
Anopheles baezai Gater 1934
Subgroup Letifer (Reid 1968)
Anopheles collessi Reid 1963
Anopheles letifer* Sandosham 1944
Anopheles roperi Reid 1950
Anopheles whartoni Reid 1963
Subgroup Separatus (Rattanarithikul et al. 2004)
Anopheles separatus Leicester 1908
Subgroup Umbrosus (Rattanarithikul et al. 2004)
Anopheles umbrosus Theobald 1903

Subgenus Baimaia[edit source | edit]

Anopheles kyondawensis Abraham 1947

Subgenus Cellia[edit source | edit]

Anopheles rageaui Mattingly and Adam

Series Cellia (Christophers 1924)

Anopheles argenteolobatus Gough 1910
Anopheles brumpti Hamon & Rickenbach 1955
Anopheles carnevalei Brunhes le Goff & Geoffroy 1999
Anopheles cristipalpis Service 1977
Anopheles murphyi Gillies & de Meillon 1968
Anopheles pharoensis Theobald 1901
Anopheles swahilicus Gillies 1964
Group Squamosus (Grjebine 1966)
Anopheles cydippis de Meillon 1931
Anopheles squamosus Theobald 1901

Series Myzomyia

Anopheles apoci Marsh 1933
Anopheles azaniae Bailly-Choumara 1960
Anopheles barberellus Evans 1932
Anopheles brunnipes Theobald 1910
Anopheles domicola Edwards 1916
Anopheles dthali Patton 1905
Anopheles erythraeus Corradetti 1939
Anopheles ethiopicus Gillies & Coetzee 1987
Anopheles flavicosta Edwards 1911
Anopheles fontinalis Gillies & de Meillon 1968
Anopheles majidi Young & Majid 1928
Anopheles moucheti* Evans 1925
subspecies bervoetsi D'Haenans 1961
subspecies moucheti Evans 1925
subspecies nigeriensis
Anopheles schwetzi Evans 1934
Anopheles tchekedii de Meillon & Leeson 1940
Anopheles walravensi Edwards 1930
Group Demeilloni (Gillies & De Meillon 1962)
Anopheles carteri Evans & de Meillon 1933
Anopheles demeilloni Evans 1933
Anopheles freetownensis Evans 1925
Anopheles garnhami Edwards 1930
Anopheles keniensis Evans 1931
Anopheles lloreti Gil Collado 1936
Anopheles sergentii* Theobald 1907
subspecies macmahoni Evans 1936
subspecies sergentii Theobald 1907
Group Funestus (Garros et al. 2004)
Anopheles jeyporiensis James 1902
Subgroup Aconitus (Chen et al. 2003)
Anopheles aconitus Dönitz 1902
Anopheles filipinae Manalang 1930
Anopheles mangyanus Banks 1906
Anopheles pampanai Buttiker & Beales 1959
Anopheles varuna Iyengar 1924
Subgroup Culicifacies (Garros et al. 2004)
Anopheles culicifacies* Giles 1901
Subgroup Funestus (Garros et al. 2004)
Anopheles aruni Sobti 1968
Anopheles confusus Evans & Leeson 1935
Anopheles funestus* Giles 1900
Anopheles funestus-like* Spillings et al. 2009[14]
Anopheles longipalpis Type C Koekemoer et al. 2009
Anopheles parensis Gillies 1962
Anopheles vaneedeni Gillies & Coetzee 1987
Subgroup Minimus (Chen et al. 2003)
Anopheles flavirostris* Ludlow 1914
Anopheles leesoni Evans 1931
Anopheles longipalpis Type A Koekemoer et al. 2009
Complex Fluviatilis (Salara et al. 1993)
Anopheles fluviatilis* (species S, T, U, V) James 1902[15]
Complex Minimus (Green et al. 1990)
Anopheles harrisoni Harbach & Manguin 2007
Anopheles minimus* Theobald 1901
Subgroup Rivulorum (Garros et al. 2004)
Anopheles brucei Service 1960
Anopheles fuscivenosus Leeson 1930
Anopheles rivulorum* Leeson 1935
Group Marshallii (Gillies & de Meillon 1968)
Anopheles austenii Theobald 1905
Anopheles berghei Vincke & Leleup 1949
Anopheles brohieri Edwards 1929
Anopheles gibbinsi Evans 1935
Anopheles hancocki Edwards 1929
Anopheles hargreavesi Evans 1927
Anopheles harperi Evans 1936
Anopheles mortiauxi Edwards 1938
Anopheles mousinhoi de Meillon & Pereira 1940
Anopheles njombiensis Peters 1955
Anopheles seydeli Edwards 1929
Complex Marshalli (Gillies & Coetzee 1987)
Anopheles hughi Lambert & Coetzee 1982
Anopheles kosiensis Coetzee, Segerman & Hunt 1987
Anopheles letabensis Lambert & Coetzee 1982
Anopheles marshallii Theobald 1903
Group Wellcomei (Gillies & de Meillon 1968)
Anopheles distinctus Newstead & Carter 1911
Anopheles erepens Gillies 1958
Anopheles theileri Edwards 1912
Anopheles wellcomei Theobald 1904
subspecies ugandae Evans 1934
subspecies ungujae White 1975
subspecies wellcomei Theobald 1904

Series Neocellia (Christophers 1924)

Anopheles ainshamsi Gad, Harbach & Harrison 2006
Anopheles dancalicus Corradetti 1939
Anopheles hervyi Brunhes, le Goff & Geoffroy 1999
Anopheles jamesii Theobald 1901
Anopheles karwari* James 1903
Anopheles maculipalpis Giles 1902
Anopheles moghulensis Christophers 1924
Anopheles paltrinierii Shidrawi & Gillies 1988
Anopheles pattoni Christophers 1926
Anopheles pretoriensis Theobald 1903
Anopheles pulcherrimus* Theobald 1902
Anopheles rufipes Gough 1910
subspecies broussesi Edwards 1929
subspecies rufipes Gough 1910
Anopheles salbaii Maffi & Coluzzi 1958
Anopheles splendidus Koidzumi 1920
Anopheles theobaldi Giles 1901
Complex Stephensi
Anopheles stephensi* Liston 1901
Complex Superpictus
Anopheles superpictus* Grassi 1899
Group Annularis (Reid 1968)
Anopheles pallidus Theobald 1901
Anopheles philippinensis* Ludlow 1902
Anopheles schueffneri Stanton 1915
Complex Annularis (Reid 1968)
Anopheles annularis* van der Wulp 1884
Complex Nivipes (Green et al. 1985)
Anopheles nivipes Theobald 1903
Group Jamesii (Rattanarithikul et al. 2004)
Anopheles jamesii Theobald 1901
Anopheles pseudojamesi Strickland & Chowdhury 1927
Anopheles splendidus Koidzumi 1920
Group Maculatus (Rattanarithikul & Green 1987)
Anopheles dispar Rattanarithikul & Harbach 1991
Anopheles greeni Rattanarithikul & Harbach 1991
Anopheles pseudowillmori Theobald 1910
Anopheles rampae
Anopheles willmori James 1903
Subgroup Maculatus (Rattanarithikul et al. 2004)
Anopheles dravidicus Christophers 1924
Anopheles maculatus* Theobald 1901
Subgroup Sawadwongporni (Rattanarithikul et al. 2004)
Anopheles notanandai Rattanarithikul & Green 1987
Anopheles sawadwongporni Rattanarithikul & Green 1987

Series Neomyzomyia (Christophers 1924)

Anopheles amictus Edwards 1921
Anopheles annulatus Haga 1930
Anopheles aurirostris Watson 1910
Anopheles dualaensis Brunhes le Goff & Geoffroy 1999
Anopheles hilli Woodhill & Lee 1944
Anopheles incognitus Brug 1931
Anopheles kochi Dönitz 1901
Anopheles kokhani Vythilingam, Jeffery & Harbach 2007
Anopheles kolambuganensis Baisas 1932
Anopheles longirostris Brug 1928
Anopheles mascarensis de Meillon 1947
Anopheles meraukensis Venhuis 1932
Anopheles novaguinensis Venhuis 1933
Anopheles saungi Colless 1955
Anopheles stookesi Colless 1955
Anopheles watsonii Leicester 1908
Complex Annulipes
Anopheles annulipes Walker 1856
Complex Lungae
Anopheles lungae Belkin & Schlosser 1944
Anopheles nataliae Belkin 1945
Anopheles solomonis Belkin, Knight & Rozeboom 1945
Complex Punctulatus
Anopheles clowi Rozeboom & Knight 1946
Anopheles farauti* Laveran 1902
Anopheles hinesorum Schmidt 2001
Anopheles irenicus Schmidt 2003
Anopheles koliensis Owen 1945
Anopheles punctulatus Dönitz 1901
Anopheles torresiensis Schmidt 2001
Group Ardensis (Gillies & de Meillon 1968)
Anopheles ardensis Theobald 1905
Anopheles buxtoni Service 1958
Anopheles cinctus Newstead & Carter 1910
Anopheles deemingi Service 1970
Anopheles eouzani Brunhes le Goff & Bousses 2003
Anopheles kingi Christophers 1923
Anopheles machardyi Edwards 1930
Anopheles maliensis Bailly-Choumara & Adam 1959
Anopheles millecampsi Lips 1960
Anopheles multicinctus Edwards 1930
Anopheles natalensis Hill & Haydon 1907
Anopheles vernus Gillies & de Meillon 1968
Anopheles vinckei de Meillon 1942
Complex Nili (Gillies & de Meillon 1968)
Anopheles carnevalei Brunhes, le Geoff & Geoffrey 1999
Anopheles nili* Theobald 1904
Anopheles ovengensis Awono-Ambene Simard Antonio-Nkonkjio & Fontenille 2004
Anopheles somalicus Rivola & Holstein 1957
Group Kochi (Rattanarithikul et al. 2004)
Anopheles kochi Donitz 1901
Group Leucosphyrus
Anopheles baisasi Colless 1957
Anopheles cristatus King & Baisas
Subgroup Elegans
Anopheles elegans James 1903
Subgroup Hackeri
Anopheles hackeri Edwards 1921
Anopheles mirans Sallum & Peyton 2005
Anopheles pujutensis Colless 1948
Anopheles recens Sallum & Peyton 2005
Anopheles sulawesi* Waktoedi 1954
Subgroup Leucosphyrus
Anopheles baimaii* Sallum & Peyton 2005
Anopheles cracens Sallum & Peyton 2005
Anopheles scanloni Sallum & Peyton 2005
Complex Dirus
Anopheles dirus* Peyton & Harrison 1979
Anopheles nemophilous Peyton & Ramalingam 1988
Anopheles takasagoensis Morishita 1946
Complex Leucosphyrus (Peyton 1990)
Anopheles balabacensis* Baisas 1936
Anopheles introlatus Colless 1957
Anopheles latens* Sallum & Peyton 2005
Anopheles leucosphyrus* Dönitz 1901
Subgroup Riparis (Peyton 1990)
Anopheles cristatus King & Baisas
Anopheles macarthuri Colless 1956
Anopheles riparis King & Baisas 1936
Group Tessellatus (Rattanarithikul et al. 2004)
Anopheles tessellatus Theobald
subspecies A. t. kalawara Stoker & Waktoedi
subspecies A. t. orientalis Swellengrebel & Swellengrebel de Graaf
subspecies A. t. tessellatus Theobald

Series Paramyzomyia (Christophers & Barraud 1931)

Group Cinereus (Gillies & de Mellion 1968)
Anopheles azevedoi Ribeiro 1969
Anopheles cinereus Theobald 1901
subspecies cinereus Theobald 1901
subspecies hispaniola Theobald 1903
Complex Turkhudi (Liston)
Anopheles turkhudi Liston 1901
subspecies telamali Saliternik & Theodor 1942
subspecies turkhudi Liston 1901
Group Listeri (Gillies & de Mellion 1968)
Anopheles listeri de Mellion 1931
Anopheles multicolor* Cambouliu 1902
Anopheles seretsei Abdulla-Chan Coetzee & Hunt 1998

Series Pyretophorus (Blanchard 1902)

Anopheles christyi Newstead & Carter 1911
Anopheles daudi Coluzzi 1958
Anopheles indefinitus Ludlow 1904
Anopheles limosus King 1932
Anopheles litoralis King 1932
Anopheles ludlowae Theobald 1903
subspecies ludlowae Theobald 1903
subspecies torakala Stoker & Waktoedi 1949
Anopheles parangensis Ludlow 1914
Anopheles vagus* Dönitz 1902
Complex Gambiae (White 1985)
Anopheles arabiensis* Patton 1905
Anopheles bwambae White 1985
Anopheles comorensis Brunhes le Goff & Geoffroy 1997
Anopheles gambiae* Giles 1902
Anopheles melas* Theobald 1903
Anopheles merus Dontiz 1902
Anopheles quadriannulatus A Theobald 1911
Anopheles quadriannulatus B Theobald 1911
Complex Subpictus (Sugana et al. 1994)
Anopheles subpictus* Grassi 1899
Complex Sundaicus (Sukowati 1999)
Anopheles epiroticus Linton & Harbach 2005
Anopheles sundaicus* Rodenwaldt 1925

Subgenus Kerteszia[edit source | edit]

Anopheles auyantepuiensis Harbach & Navarro 1996
Anopheles bambusicolus Komp 1937
Anopheles bellator* Dyar & Knab 1906
Anopheles boliviensis Theobald 1905
Anopheles cruzii* Dyar & Knab 1908
Anopheles gonzalezrinconesi Cova Garcia, Pulido & de Ugueto, 1977
Anopheles homunculus* Komp 1937
Anopheles laneanus Corrêa & Cerqueira 1944
Anopheles lepidotus Zavortink 1973
Anopheles neivai Howard, Dyar & Knab 1913
Anopheles pholidotus Zavortink 1973
Anopheles rollai Cova Garcia, Pulido & de Ugueto 1977

Note: Anopheles cruzii is known to be a species complex,[16] but the number species in this complex has yet to be finalised.

Subgenus Lophopodomyia[edit source | edit]

Anopheles gilesi Peryassu 1928
Anopheles gomezdelatorrei Levi-Castillo 1955
Anopheles oiketorakras Osorno-Mesa 1947
Anopheles pseudotibiamaculata Galvao & Barretto 1941
Anopheles squamifemur Antunes 1937
Anopheles vargasi Gabaldon Cova Garcia & Lopez 1941

Subgenus Nyssorhynchus[edit source | edit]

Anopheles dominicanus Zavortinkb and Poinarab 2000
Section Albimanus
Anopheles noroestensis Galvao and Lane 1937
Series Albimanus (Faran 1980)
Anopheles albimanus* Weidemann 1820
Series Oswaldoi (Faran 1980)
Group Oswaldoi (Faran 1980)
Subgroup Oswaldoi (Faran 1980)
Anopheles anomalphyllus Komp
Anopheles aquasalis* Curry 1932
Anopheles dunhamii Causey 1945
Anopheles evansae Brethes 1926
Anopheles galvaoi Causey, Deane and Deane 1943
Anopheles ininii Sevenet & Abonnenc 1938
Anopheles konderi Galvfio & Damasceno 1942
Anopheles oswaldoi Peryassú 1922
Anopheles rangeli Galabadon, Cova-Garcia & Lopez 1941
Anopheles sanctielii Sevenet & Abonnenc 1938
Anopheles trinkae Faran 1980
Complex Nuneztovari (Conn et al. 1993)
Anopheles geoeldii Rozeboom and Gabaldón 1941
Anopheles nuneztovari* Galbadón 1940
Subgroup Strodei (Faran 1980)
Anopheles alberto
Anopheles arthuri*
Anopheles benarrochi Galabadon, Cova-Garcia & Lopez
Anopheles rondoni Neiva & Pinto 1922
Anopheles strodei Root 1926
Group Triannulatus
Anopheles halophylus do Nascimento & de Oliveira 2002
Anopheles triannulatus Neiva & Pinto 1922
Section Argyritarsis (Levi Castillo 1949)
Series Albitarsis (Linthicum 1988)
Anopheles rooti Brethes 1926
Group Albitarsis (Linthicum 1988)
Anopheles albitarsis Linthicum 1988
Anopheles deaneorum Rosa-Freitas 1989
Anopheles janconnae Wilkerson & Sallum 2009
Anopheles oryzalimnetes Wilkerson & Motoki 2009
Anopheles marajoara* Galvao & Damesceno 1942
Group Braziliensis (Linthicum 1988)
Anopheles braziliensis Chagas 1907
Series Argyritarsis (Linthicum 1988)
Group Argyritarsis (Linthicum 1988)
Anopheles argyitarsis Robineau-Desvoidy 1827
Anopheles sawyeri Causey, Deane, Deane & Sampaio 1943
Group Darlingi (Linthicum 1988)
Anopheles darlingi* Root
Group Lanie (Linthicum 1988)
Anopheles lanei Galvao & Amaral 1938
Group Pictipennis (Linthicum 1988)
Anopheles pictipennis Phillippi 1865
Section Myzorhynchella (Peyton et al. 1992)
Anopheles antunesi Galvao & Amaral 1940
Anopheles lutzii Cruz 1901
Anopheles nigritarsis Chagas 1907
Anopheles parvus Chagas 1907

Subgenus Stethomyia[edit source | edit]

Anopheles acanthotorynus Komp 1937
Anopheles canorii Floch & Abonnenc 1945
Anopheles kompi Edwards 1930
Anopheles nimbus Theobald 1902
Anopheles thomasi Shannon 1933

Notes[edit source | edit]

  • Anopheles anthropophagus Xu and Feng is considered to be a junior synonym of Anopheles lesteri de Meillon 1931.
  • Anopheles bonneorum Fonseca & Ramos is considered to be a synonym of Anopheles costai.
  • Anopheles lewisi Ludlow 1920 is a synonym of Anopheles thomasi Shannon 1933.
  • Anopheles lineata Lutz is a synonym of Anopheles nimbus Theobald.
  • Anopheles mesopotamiae is considered to be a synonym of Anopheles hyrcanus.
  • Anopheles rossii Giles 1899 was originally described as Anopheles subpictus Grassi 1899.
  • Bironella derooki is a synonym of Anopheles soesiloi.

The following are currently regarded as nomina nuda:

  • Anopheles (Anopheles) solomonensis Cumpston 1924
  • Anopheles (Cellia) melanotarsis Woodhill & Lee

A subgroup of Anopheles gambiae sensu stricto has been reported and given the name Goundry. This subgroup has not yet been elevated to species status.[17]

References[edit source | edit]

  1. ^ Krzywinski J. and Besansky N.J. (2003) Molecular systematics of Anopheles: From Subgenera to Subpopulations. Ann. Review Entomol. Vol. 48: 111-139
  2. ^ Foley D.H., Bryan J.H., Yeates D. and Saul A. (1998) Evolution and systematics of Anopheles:Insights from a molecular phylogeny of Australasian mosquitoes. Mol. Phylo. Evol. 9 (2) 262-275
  3. ^ Calle DA, Quiñones ML, Erazo HF, Jaramillo N.(2008) Differentiation by geometric morphometrics among 11 Anopheles (Nyssorhynchus) in Colombia Biomedica. 28(3):371-385
  4. ^ Rattanarithikul R., Harrison B.A., Harbach R.E., Panthusiri P., Coleman R.E., Panthusiri P. (2006) Illustrated keys to the mosquitoes of Thailand. IV. Anopheles. Southeast Asian J Trop Med Public Health. 37 Suppl 2:1-128
  5. ^ Sedaghat M.M., Harbach R.E. (2005) An annotated checklist of the Anopheles mosquitoes (Diptera: Culicidae) in Iran. J Vector Ecol. 30(2):272-276
  6. ^ Walton C, Somboon P, O'Loughlin SM, Zhang S, Harbach RE, Linton YM, Chen B, Nolan K, Duong S, Fong MY, Vythilingum I, Mohammed ZD, Trung HD, Butlin RK (2007) Genetic diversity and molecular identification of mosquito species in the Anopheles maculatus group using the ITS2 region of rDNA. Infect Genet Evol. 7(1):93-102
  7. ^ Garros C, Harbach RE, Manguin S. (2005) Morphological assessment and molecular phylogenetics of the Funestus and Minimus groups of Anopheles (Cellia). J Med Entomol. 42(4):522-536
  8. ^ Harbach RE, Kitching IJ (2005) Reconsideration of anopheline mosquito phylogeny (Diptera: Culicidae: Anophelinae) based on morphological data. Systematics Biodiv. 3 (4) 345 - 374
  9. ^ a b Moreno M, Marinotti O, Krzywinski J, Tadei WP, James AA, Achee NL, Conn JE (2010) Complete mtDNA genomes of Anopheles darlingi and an approach to anopheline divergence time. Malar J. 9:127
  10. ^ Eric Calvo, Van M Pham, Osvaldo Marinotti, John F. Andersen & José M. C. Ribeiro (2009). "The salivary gland transcriptome of the neotropical malaria vector Anopheles darlingi reveals accelerated evolution of genes relevant to hematophagy". BMC Genomics 10 (1): 57. doi:10.1186/1471-2164-10-57. PMC 2644710. PMID 19178717. 
  11. ^ Scarpassa VM, Conn JE (2011) Mitochondrial DNA detects a complex evolutionary history with Pleistocene epoch divergence for the Neotropical malaria vector Anopheles nuneztovari sensu lato. Am J Trop Med Hyg 85(5):857-867
  12. ^ de Souza DK, Koudou BG, Bolay FK, Boakye DA, Bockarie MJ (2013) Filling the gap 115 years after Ronald Ross: The distribution of the Anopheles coluzzii and Anopheles gambiae s.s from Freetown and Monrovia, West Africa. PLoS One 8(5):e64939. doi: 10.1371/journal.pone.0064939
  13. ^ Kamali M, Xia A, Tu Z, Sharakhov IV (2012) A new chromosomal phylogeny supports the repeated origin of vectorial capacity in malaria mosquitoes of the Anopheles gambiae complex. PLoS Pathog 8(10):e1002960. doi: 10.1371/journal.ppat.1002960
  14. ^ Spillings BL, Brooke BD, Koekemoer LL, Chiphwanya J, Coetzee M, Hunt RH (2009) A new species concealed by Anopheles funestus Giles, a major malaria vector in Africa. Am J Trop Med Hyg 81(3):510-5
  15. ^ Nanda N, Singh OP, Dua VK, Pandey AC, Nagpal BN, Adak T, Dash AP, Subbarao SK (2012) Population cytogenetic and molecular evidence for existence of a new Species in Anopheles fluviatilis complex (Diptera: Culicidae).Infect Genet Evol pii: S1567-1348(12)00331-0. doi: 10.1016/j.meegid.2012.09.018
  16. ^ Rona LD, Carvalho-Pinto CJ, Peixoto AA (2010) Molecular evidence for the occurrence of a new sibling species within the Anopheles (Kerteszia) cruzii complex in south-east Brazil. Malar J 26, 9(1):33
  17. ^ Riehle MM, Guelbeogo WM, Gneme A, Eiglmeier K, Holm I, Bischoff E, Garnier T, Snyder GM, Li X, Markianos K, Sagnon N, Vernick KD (2011) A cryptic subgroup of Anopheles gambiae is highly susceptible to human malaria parasites. Science 331 (6017) 596-598 doi:10.1126/science.1196759
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Anopheles

Anopheles, pronounced /əˈnɒfɨliːz/,[1] is a genus of mosquito. There are approximately 460 recognised species: while over 100 can transmit human malaria, only 30-40 commonly transmit parasites of the genus Plasmodium, which cause malaria in humans in endemic areas. Anopheles gambiae is one of the best known, because of its predominant role in the transmission of the most dangerous malaria parasite species - Plasmodium falciparum.

The name comes from the Greek αν an meaning not and ωφελής óphelos meaning profit and translates to useless .[1]

Some species of Anopheles also can serve as the vectors for canine heartworm Dirofilaria immitis, the Filariidae Wuchereria bancrofti and Brugia malayi, and viruses such as one that causes O'nyong'nyong fever. There is an association of brain tumor incidence and malaria, suggesting that the anopheles might transmit a virus or other agent that could cause a brain tumor.[2]

Mosquitoes in other genera (Aedes, Culex) can also serve as vectors of disease agents.

Contents

Evolution

The Culicine and Anopheles clades diverged ~150 million years ago.[3] The Old and New World Anopheles species subsequently diverged ~95 million years ago.[3] The Anopheles gambiae and Anopheles funestus clades diverged 36-80 million years ago. A molecular study of several genes in seven species has provided additional supposrt of the for an expansion of this genus during the Cretaceous period.[4]

The Anopheles genome (230-284 Mb) is comparable in size to that of Drosophilia but considerably smaller than those found in other culicine genomes (528 Mb-1.9 Gb). Like most culicine species, the genome is diploid with six chromosomes.

The only known fossils of this genus are those of Anopheles (?Nyssorhynchus) dominicanus Zavortink & Poinar contained in Dominican amber from the Late Eocene (33.9-40.4 Mya) and Anopheles rottensis Statz contained in German amber from the Late Oligocene (23.0-28.4 Mya).

Systematics

The genus Anopheles belongs to a subfamily Anophelinae with three genera: Anopheles Meigen (nearly worldwide distribution), Bironella Theobald (Australia only) and Chagasia Cruz (Neotropics). Bironella appears to be the sister taxon to the Anopheles with Chagasia forming the outgroup in this subfamily.

The classification of this genus began in 1901 with Theobald. Despite the passage of time the taxonomy remains incompletely settled. Classification into species is based on morphological characteristics - wing spots, head anatomy, larval and pupal anatomy, chromosome structure - and more recently on DNA sequences.

The genus itself has been subdivided into seven subgenera based primarily on the number and positions of specialized setae on the gonocoxites of the male genitalia. The system of subgenera originated with the work of Christophers who in 1915 described three subgenera: Anopheles (widely distributed), Myzomyia (later renamed Cellia) (Old World) and Nyssorhynchus (Neotropical). Nyssorhynchus was first described as Lavernia by Theobald. Edwards in 1932 added the subgenus Stethomyia (Neotropical distribution). Kerteszia was also described by Edwards in 1932 but then recognised as a subgrouping of Nyssorhynchus. It was elevated to subgenus status by Komp in 1937 and it is also found in the Neotropics. Two additional subgenera have since been recognised: Baimaia (Southeast Asia only) by Harbach et al. in 2005 and Lophopodomyia (Neotropical) by Antunes in 1937.

Within the genus Anopheles there are two main groupings: one formed by the Cellia and Anopheles subgenera and a second by Kerteszia, Lophopodomyia and Nyssorhynchus. Subgenus Stethomyia is an outlier with respect to these two taxa. Within the second group Kerteszia and Nyssorhynchus appear to be sister taxa.

The number of species currently recognised within the subgenera is given here in parentheses: Anopheles (206 species), Baimaia (1), Cellia (216), Kerteszia (12), Lophopodomyia (6), Nyssorhynchus (34) and Stethomyia (5).

Taxonomic units between subgenus and species are not currently recognised as official zoological names. In practice a number of taxonomic levels have been introduced. The larger subgenera (Anopheles, Cellia and Nyssorhynchus) have been subdivided into sections and series which in turn have been divided into groups and subgroups. Below subgroup but above species level is the species complex. Taxonomic levels above species complex can be distinguished on morphological grounds. Species within a species complex are either morphologically identical or extremely similar and can only be reliably separated by microscopic examination of the chromosomes or DNA sequencing. The classification continues to be revised.

Subgenus Nyssorhynchus has been divided in three sections: Albimanus (19 species), Argyritarsis (11 species) and Myzorhynchella (4 species). The Argyritarsis section has been sub divided into Albitarsis and Argyritarsis groups.

The Anopheles Group was divided by Edwards into four series: Anopheles (worldwide), Myzorhynchus (Palearctic, Oriental, Australasian and Afrotropical), Cycloleppteron (Neotropical) and Lophoscelomyia (Oriental); and two groups, Arribalzagia (Neotropical) and Christya (Afrotropical). Reid and Knight (1961) modified this classification and consequently subdivided the subgenus Anopheles into two sections, Angusticorn and Laticorn and six series. The Arribalzagia and Christya Groups were considered to be series. The Laticorn Section includes the Arribalzagia (24 species), Christya and Myzorhynchus Series. The Angusticorn Section includes members of the Anopheles, Cycloleppteron and Lophoscelomyia Series.

All species known to carry human malaria lie within either the Myzorhynchus or the Anopheles Series.

Life stages

Like all mosquitoes, anophelines go through four stages in their life cycle: egg, larva, pupa, and imago. The first three stages are aquatic and last 5–14 days, depending on the species and the ambient temperature. The adult stage is when the female Anopheles mosquito acts as malaria vector. The adult females can live up to a month (or more in captivity) but most probably do not live more than 1–2 weeks in nature.

Eggs

Adult females lay 50-200 eggs per oviposition. The eggs are quite small (~0.5 x 0.2 mm). Eggs are laid singly and directly on water. They are unique in that they have floats on either side. Eggs are not resistant to drying and hatch within 2–3 days, although hatching may take up to 2–3 weeks in colder climates.

Larvae

Anopheles larva from southern Germany, about 8 mm long.

Mosquito larvae have a well-developed head with mouth brushes used for feeding, a large thorax and a nine segmented abdomen. They don't have legs. In contrast to other mosquitoes, Anopheles larvae lack a respiratory siphon and for this reason position themselves so that their body is parallel to the surface of the water.

Larvae breathe through spiracles located on the 8th abdominal segment and therefore must come to the surface frequently. The larvae spend most of their time feeding on algae, bacteria, and other microorganisms in the surface microlayer. They dive below the surface only when disturbed. Larvae swim either by jerky movements of the entire body or through propulsion with the mouth brushes.

Larvae develop through 4 stages, or instars, after which they metamorphose into pupae. At the end of each instar, the larvae molt, shedding their exoskeleton, or skin, to allow for further growth. 1st stage larvae are ~1 mm in length; 4th stage larvae are normally 5–8 mm in length.

The process from egg laying to emergence of the adult is temperature dependent with a minimum time of 7 days.

The larvae occur in a wide range of habitats but most species prefer clean, unpolluted water. Larvae of Anopheles mosquitoes have been found in fresh- or salt-water marshes, mangrove swamps, rice fields, grassy ditches, the edges of streams and rivers, and small, temporary rain pools. Many species prefer habitats with vegetation. Others prefer habitats that have none. Some breed in open, sun-lit pools while others are found only in shaded breeding sites in forests. A few species breed in tree holes or the leaf axils of some plants.

Pupae

The pupa is comma-shaped when viewed from the side. The head and thorax are merged into a cephalothorax with the abdomen curving around underneath. As with the larvae, pupae must come to the surface frequently to breathe, which they do through a pair of respiratory trumpets on the cephalothorax. After a few days as a pupa, the dorsal surface of the cephalothorax splits and the adult mosquito emerges.

Adults

The duration from egg to adult varies considerably among species and is strongly influenced by ambient temperature. Mosquitoes can develop from egg to adult in as little as 5 days but usually take 10–14 days in tropical conditions.

Like all mosquitoes, adult Anopheles have slender bodies with 3 sections: head, thorax and abdomen.

The head is specialized for acquiring sensory information and for feeding. The head contains the eyes and a pair of long, many-segmented antennae. The antennae are important for detecting host odors as well as odors of breeding sites where females lay eggs. The head also has an elongated, forward-projecting proboscis used for feeding, and two sensory palps.

The thorax is specialized for locomotion. Three pairs of legs and a pair of wings are attached to the thorax.

The abdomen is specialized for food digestion and egg development. This segmented body part expands considerably when a female takes a blood meal. The blood is digested over time serving as a source of protein for the production of eggs, which gradually fill the abdomen.

Anopheles mosquitoes can be distinguished from other mosquitoes by the palps, which are as long as the proboscis, and by the presence of discrete blocks of black and white scales on the wings. Adult Anopheles can also be identified by their typical resting position: males and females rest with their abdomens sticking up in the air rather than parallel to the surface on which they are resting.

Adult mosquitoes usually mate within a few days after emerging from the pupal stage. In most species, the males form large swarms, usually around dusk, and the females fly into the swarms to mate.

Males live for about a week, feeding on nectar and other sources of sugar. Females will also feed on sugar sources for energy but usually require a blood meal for the development of eggs. After obtaining a full blood meal, the female will rest for a few days while the blood is digested and eggs are developed. This process depends on the temperature but usually takes 2–3 days in tropical conditions. Once the eggs are fully developed, the female lays them and resumes host seeking.

The cycle repeats itself until the female dies. While females can live longer than a month in captivity, most do not live longer than 1–2 weeks in nature. Their lifespan depends on temperature, humidity, and also their ability to successfully obtain a blood meal while avoiding host defenses.

Habitat

Although malaria is nowadays limited to tropical areas, most notoriously regions of sub-Saharan Africa, many Anopheles species live in colder latitudes (see this map from the CDC). Indeed, malaria outbreaks have, in the past, occurred in colder climates, for example during the construction of the Rideau Canal in Canada during the 1820s.[5] Since then, the Plasmodium parasite (not the Anopheles mosquito) has been eliminated from first world countries.

The CDC warns, however, that "Anopheles that can transmit malaria are found not only in malaria-endemic areas, but also in areas where malaria has been eliminated. The latter areas are thus constantly at risk of re-introduction of the disease."

Susceptibility to become a vector of disease

Some species are poor vectors of malaria, as the parasites do not develop well (or at all) within them. There is also variation within species. In the laboratory, it has been possible to select for strains of A. gambiae that are refractory to infection by malaria parasites. These refractory strains have an immune response that encapsulates and kills the parasites after they have invaded the mosquito's stomach wall. Scientists are studying the genetic mechanism for this response. It is hoped that some day, genetically modified mosquitoes that are refractory to malaria can replace wild mosquitoes, thereby limiting or eliminating malaria transmission.

Malaria transmission and control

Understanding the biology and behavior of Anopheles mosquitoes can help understand how malaria is transmitted and can aid in designing appropriate control strategies. Factors that affect a mosquito's ability to transmit malaria include its innate susceptibility to Plasmodium, its host choice and its longevity. Factors that should be taken into consideration when designing a control program include the susceptibility of malaria vectors to insecticides and the preferred feeding and resting location of adult mosquitoes.

On December 21, 2007, a study published in PLoS Pathogens found that the hemolytic C-type lectin CEL-III from Cucumaria echinata, a sea cucumber found in the Bay of Bengal, impaired the development of the malaria parasite when produced by transgenic A. stephensi.[6] This could potentially be used one day to control malaria by spreading genetically modified mosquitoes refractory to the parasites, although there are numerous scientific and ethical issues to be overcome before such a control strategy could be implemented.

Preferred sources for blood meals

One important behavioral factor is the degree to which an Anopheles species prefers to feed on humans (anthropophily) or animals such as cattle (zoophily). Anthropophilic Anopheles are more likely to transmit the malaria parasites from one person to another. Most Anopheles mosquitoes are not exclusively anthropophilic or zoophilic. However, the primary malaria vectors in Africa, A. gambiae and A. funestus, are strongly anthropophilic and, consequently, are two of the most efficient malaria vectors in the world.

Once ingested by a mosquito, malaria parasites must undergo development within the mosquito before they are infectious to humans. The time required for development in the mosquito (the extrinsic incubation period) ranges from 10–21 days, depending on the parasite species and the temperature. If a mosquito does not survive longer than the extrinsic incubation period, then she will not be able to transmit any malaria parasites.

It is not possible to measure directly the life span of mosquitoes in nature. But indirect estimates of daily survivorship have been made for several Anopheles species. Estimates of daily survivorship of A. gambiae in Tanzania ranged from 0.77 to 0.84 meaning that at the end of one day between 77% and 84% will have survived.[7]

Assuming this survivorship is constant through the adult life of a mosquito, less than 10% of female A. gambiae would survive longer than a 14-day extrinsic incubation period. If daily survivorship increased to 0.9, over 20% of mosquitoes would survive longer than a 14-day extrinsic incubation period. Control measures that rely on insecticides (e.g. indoor residual spraying) may actually impact malaria transmission more through their effect on adult longevity than through their effect on the population of adult mosquitoes.

Patterns of feeding and resting

Most Anopheles mosquitoes are crepuscular (active at dusk or dawn) or nocturnal (active at night). Some Anopheles mosquitoes feed indoors (endophagic) while others feed outdoors (exophagic). After feeding, some blood mosquitoes prefer to rest indoors (endophilic) while others prefer to rest outdoors (exophilic), though this can differ regionally based on local vector ecotype, and vector chromosomal makeup, as well as housing type and local microclimatic conditions. Biting by nocturnal, endophagic Anopheles mosquitoes can be markedly reduced through the use of insecticide-treated bed nets (ITNs) or through improved housing construction to prevent mosquito entry (e.g. window screens). Endophilic mosquitoes are readily controlled by indoor spraying of residual insecticides. In contrast, exophagic/exophilic vectors are best controlled through source reduction (destruction of the breeding sites).

Insecticide resistance

Insecticide-based control measures (e.g. indoor spraying with insecticides, ITNs) are the principal way to kill mosquitoes that bite indoors. However, after prolonged exposure to an insecticide over several generations, mosquitoes, like other insects, may develop resistance, a capacity to survive contact with an insecticide. Since mosquitoes can have many generations per year, high levels of resistance can arise very quickly. Resistance of mosquitoes to some insecticides has been documented with just within a few years after the insecticides were introduced. There are over 125 mosquito species with documented resistance to one or more insecticides. The development of resistance to insecticides used for indoor residual spraying was a major impediment during the Global Malaria Eradication Campaign. Judicious use of insecticides for mosquito control can limit the development and spread of resistance. However, use of insecticides in agriculture has often been implicated as contributing to resistance in mosquito populations. It is possible to detect developing resistance in mosquitoes and control programs are well advised to conduct surveillance for this potential problem.

Eradication

With increasing numbers of malaria cases affecting people around the globe, in tropical and subtropical regions, especially in sub-Saharan Africa where millions of kids are killed by this infectious disease, eradication is back on the global health agenda. [8]

Although malaria has existed since old times, its eradication was possible in Europe, North America, the Caribbean and parts of Asia and South-Central America during the first regional elimination campaigns in the late 1940s. However, the same results were not achieved in sub-Saharan Africa. [9]

Even though the World Health Organization adopted a formal policy on the control and eradication of the malaria parasite since 1955, [10] it was recently, after the Gates Malaria Forum in October 2007, that key organizations started the debate on the pros and cons of redefining eradication as a goal to control malaria.

Clearly, the cost of preventing malaria is much less than treating the disease in the long run. However, eradication of mosquito is not an easy task. For effective prevention of malaria, some conditions should be met such as conducive conditions in the country, data collection about the disease, targeted technical approach to the problem, very active and committed leadership, government’s total support, monetary free hand, community involvement, skilled technicians from different fields as well as an adequate implementation.[11]

There is a wide range of strategies to achieve malaria eradication that start from simple steps to complicated strategies which may not be possible to enforce with the current tools.

Although mosquito control is an important component of malaria control strategy, elimination of malaria in an area does not require the elimination of all Anopheles mosquitoes. For instance, in North America and Europe, although the vector Anopheles mosquitoes are still present, the parasite has been eliminated. There are also some socio-economic improvements (e.g., houses with screened windows, air conditioning) that once combined with vector reduction efforts and effective treatment lead to the elimination of malaria without the complete elimination of the vectors. Some important measures in mosquito control to be followed are: discourage egg laying, prevent development of eggs into larvae and adults, kill the adult mosquitoes, do not allow adult mosquitoes into places of human dwelling, prevent mosquitoes from biting human beings and deny blood meal. [12]

Research in this sense continues, and a study has suggested that sterile mosquitoes might be the answer to malaria elimination. This research suggests that using the Sterile Insect Technique (STI)in which sexually sterile male insects are released to wipe out a pest population could be a solution to the problem of malaria in Africa. This technique brings hope as female mosquitoes only mate once during their lifetimes, and in doing so with sterile male mosquitoes, the insect population would decrease. [13] This is another option to be considered by local and international authorities that may be combined with other methods and tools to achieve malaria eradication in sub Saharan African.

Parasites

A number of parasites of this genus are known to exist including microsporidia of the genera Amblyospora, Crepidulospora, Senoma and Parathelohania.[14]

Microsporida infecting the aquatic stages of insects - a group that includes mosquitoes and black flies - and copepods appear to form a distinct clade from those infecting terrestrial insects and fish. There are two distinct life cycles in this group: in the first type the parasite is transmitted by the oral route and is relatively non species specific. In the second while again the oral route is the usual route of infection, the parasite is ingested within an already infected intermediate host. Infection of the insect larval form is frequently tissue specific commonly involves the fat body. Vertical (transovarial) transmission is also known to occur.

Few phylogenetic studies of these parasites have been done and their the relationship to their mosquito hosts is still being determined. One study suggested that Parathelohania is an early diverging genus within this group.[15]

The parasite Wolbachia has been studied for a control agent.[16]

See also

Source

References

  1. ^ a b Anopheles at dictionary.com.
  2. ^ Lehrer Anopheles mosquito transmission of brain tumor. Med Hypotheses. 2010 Jan;74(1):167-8. Epub 2009 Aug 4. [1]
  3. ^ a b Calvo E, Pham VM, Marinotti O, Andersen JF, Ribeiro JM. (2009) The salivary gland transcriptome of the neotropical malaria vector Anopheles darlingi reveals accelerated evolution of genes relevant to hematophagy. BMC Genomics. 10(1):57
  4. ^ Dixit J, Srivastava H, Sharma M, Das MK, Singh OP, Raghavendra K, Nanda N, Dash AP, Saksena DN, Das A (2010) Phylogenetic inference of Indian malaria vectors from multilocus DNA sequences. Infect. Genet. Evol.
  5. ^ Wylie, William N. T. (1983), "Poverty, Distress, and Disease: Labour and the Construction of the Rideau Canal, 1826-32", Labour / Le Travail 11: 7–29, http://www.jstor.org/stable/25140199 .
  6. ^ Yoshida S, Shimada Y, Kondoh D, et al. (2007). "Hemolytic C-type lectin CEL-III from sea cucumber expressed in transgenic mosquitoes impairs malaria parasite development". PLoS Pathog. 3 (12): e192. doi:10.1371/journal.ppat.0030192. PMID 18159942. http://www.plospathogens.org/article/info:doi/10.1371/journal.ppat.0030192. 
  7. ^ (Charlwood et al., 1997, Survival And Infection Probabilities of Anthropophagic Anophelines From An Area of High Prevalence of Plasmodium falciparum in Humans, Bulletin of Entomological Research, 87, 445-453)
  8. ^ "Malaria eradication back on the table". http://www.who.int/bulletin/volumes/86/2/07-050633/en/. Retrieved 2010-05-04. 
  9. ^ "Malaria eradication back on the table". http://www.who.int/bulletin/volumes/86/2/07-050633/en/. Retrieved 2010-05-04. 
  10. ^ "Malaria Eradication". http://www.cwru.edu/med/epidbio/mphp439/Malaria.htm. Retrieved 2010-05-04. 
  11. ^ "Mosquito Eradication". http://www.malariasymptoms.org/malaria-preventing.html. Retrieved 2010-05-04. 
  12. ^ "Mosquito Control". http://www.malariasite.com/MALARIA/mosquito_control.htm. Retrieved 2010-05-04. 
  13. ^ "Are sterile mosquitoes the answer to malaria elimination?". http://esciencenews.com/articles/2009/11/16/are.sterile.mosquitoes.answer.malaria.elimination. Retrieved 2010-05-04. 
  14. ^ Simakova A.V., Pankova T.F. (2008) Ecology and epizootology of microsporidia in malarial mosquitoes (Diptera: Culicidae) from the south of western Siberia. Parazitologiia. 42(2):139-150
  15. ^ Baker MD, Vossbrinck CR, Becnel JJ, Andreadis TG. (1998) Phylogeny of amblyospora (Microsporida: amblyosporidae) and related genera based on small subunit ribosomal DNA data: A possible example of host parasite cospeciation. J. Invertebr. Pathol. 71(3):199-206
  16. ^ http://news.discovery.com/animals/mosquito-parasite-disease-fighting.html
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!