Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Catocala ilia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATCATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCTCGTATAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTATACCCCCCTCTTTCTTCTAATATTGCTCATAGAGGTAGATCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGACTAAATAATTTAATGTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACTGCATTTCTTTTACTTCTTTCATTACCAGTATTAGCCGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCCTTCTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catocala ilia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 39
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Catocala ilia

The Ilia Underwing, Beloved Underwing or Wife Underwing (Catocala ilia) is a moth of the Noctuidae family. The species can be found in the Eastern part of the United States as well as southern Canada. Subspecies Catocala ilia zoe can be found in California and Arizona.

Ilia Underwing.jpg

The wingspan is 65–82 mm. The moths flies from June to September depending on the location.

The larvae feed on Oak, including black, burr, red, and white oaks.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!