Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Catocala amica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGACTTCTTCCCCCCTCACTAACTTTATTAATTTCGAGAAGAATTGTAGAAAGTGGAGCAGGAACTGGATGAACAGTGTACCCCCCTCTCTCTTCTAATATTGCTCATGGAGGTAGCTCAGTAGATTTAGCTATTTTTTCCCTTCATCTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTAATATTTGACCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTTCTTCTTCTTCTTTCTTTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACCGATCGAAATTTAAATACTTCTTTCTTTGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catocala amica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catocala amica sp. 2

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catocala amica sp. 3

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 24
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catocala amica sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catocala amica sp. 2-RJB

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Catocala amica

The Girlfriend Underwing (Catocala amica) is an owlet moth species. It is found from southern Canada (Ontario and Quebec) through the United States east of the Rocky Mountains, ranging westward to Oklahoma and Arizona, northward to Minnesota and southwestward to Texas.

Description and ecology[edit]

The wingspan of adults is 35–40 mm. They are generally easy to recognize by the cryptically patterned forewings, the yellow background color of their hindwings, and the black pattern on the latter. This consists of a black band along the outer edge, save for the hindmost part where a separate black dot is found. Forewing hue varies a lot, but similar sympatric species usually have an additional black band running across the central hindwings. Unlike in many (but not all) other underwing moths, their tibiae are all spineless.[2]

Adults are on the wing from June to September[citation needed] depending on the location; they are often attracted to UV light at night. The caterpillars feed on oak (Quercus) species, including.[2]

Of section Quercus

Of section Lobatae

Classification[edit]

This moth is placed in the subfamily Catocalinae, either of the owlet moth family, Noctuidae, or – if the Noctuidae are circumscribed more strictly – of family Erebidae. Within the Catocalinae, it belongs to tribe Catocalini and – if the Noctuidae are circumscribed widely – subtribe Catocalina.

The former subspecies C. a. lineella, which occurs to the north and east of the Girlfriend Underwing, is now again considered to be a valid species Catocala lineella (Little Lined Underwing or Steely Underwing).

C. amica is the type species of Corisce, initially proposed to be a distinct genus. Given that phylogeny and monophyly of Catocala in its present circumscription are unresolved, and that the Girlfriend Underwing and its closest relatives look quite different from their supposed congeners, Corisce might ultimately be revalidated. However, C. amica closely resembles other more usually-colored Catocala in possessing no spines at all on the tibiae.[3]

Footnotes[edit]

  1. ^ See references in Savela (2012)
  2. ^ a b Nelson & Loy (1983)
  3. ^ Nelson & Loy (1983), Pitkin & Jenkins (2004)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!