Articles on this page are available in 1 other language: German (1) (learn more)

Overview

Distribution

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Associations

In Great Britain and/or Ireland:
Plant / pollenated
adult of Autographa gamma pollenates or fertilises flower of Platanthera chlorantha

Foodplant / open feeder
nocturnal caterpillar of Autographa gamma grazes on live leaf of Phaseolus

Foodplant / open feeder
nocturnal caterpillar of Autographa gamma grazes on live leaf of Solanum tuberosum

Foodplant / open feeder
nocturnal caterpillar of Autographa gamma grazes on live leaf of Brassica oleracea

Foodplant / open feeder
nocturnal caterpillar of Autographa gamma grazes on live leaf of Lactuca sativa

Animal / parasitoid / endoparasitoid
larva of Gonia ornata is endoparasitoid of larva of Autographa gamma

Animal / parasitoid / endoparasitoid
larva of Nemorilla floralis is endoparasitoid of larva of Autographa gamma

Animal / parasitoid / endoparasitoid
larva of Nilea hortulana is endoparasitoid of larva of Autographa gamma

Animal / parasitoid / endoparasitoid
larva of Phryxe nemea is endoparasitoid of larva of Autographa gamma

Animal / parasitoid / endoparasitoid
larva of Phryxe vulgaris is endoparasitoid of larva of Autographa gamma

Animal / parasitoid / endoparasitoid
larva of Voria ruralis is endoparasitoid of larva of Autographa gamma

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Autographa gamma

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 44
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Autographa gamma

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATATTTTATTTTTGGTATTTGAGCTGGAATAGTTGGTACATCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGACTCGTTCCTCTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAACATAAGTTTTTGACTTTTACCCCCATCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGTACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATCGCCCATGGTGGAAGATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATCTGAGCTGTTGGAATTACAGCTTTCCTTTTATTACTTTCTTTACCTGTTTTAGCAGGGGCAATTACTATACTTTTAACAGATCGTAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGACCCAATCTTATACCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Silver Y

The Silver Y (Autographa gamma) is a migratory moth of the family Noctuidae which is named for the silvery Y-shaped mark on each of its forewings.

Description[edit]

The Silver Y is a medium-sized moth with a wingspan of 30 to 45 mm. The wings are intricately patterned with various shades of brown and grey providing excellent camouflage. In the centre of each forewing there is a silver-coloured mark shaped like a letter Y or a Greek letter Gamma. There are several different forms with varying colours depending on the climate in which the larvae grow.

A. gamma profile
A. gamma mounted specimen

Distribution[edit]

The species is widespread across Europe, parts of Asia, and North Africa[citation needed]. It is resident in the south of its range and adults fly almost throughout the year[citation needed]. In spring variable numbers migrate north reaching as far as Iceland, Greenland, and Finland with huge invasions taking place in some years[citation needed]. A second wave of migrants arrives in the summer[citation needed]. In central Europe and the British Isles adults are present in significant numbers from May onwards with numbers dwindling in late autumn as they are killed off by frosts[citation needed]. Some individuals fly south again to winter around the Mediterranean and Black Seas[citation needed].

It occurs in a wide variety of habitats, particularly open areas. It regularly visits gardens to take nectar from the flowers.

Life history[edit]

Caterpillar on carrot (Daucus carota) stem

Silver Y moths can produce two or three generations in a year with a fourth generation when conditions are particularly good. The eggs are laid on the upper or lower surface of leaves. They are whitish in colour and hemispherical in shape with deep ribbing. They hatch after three to four days (longer in cool conditions).

The larvae are about 30 mm long, have three pairs of prolegs and are usually green with whitish markings. They feed on a wide variety of low-growing plants and have been recorded on over 200 different species including crops such as the garden pea (Pisum sativum), sugar beet (Beta vulgaris) and cabbage (Brassica oleracea).[1] They can reduce crop yields by damaging leaves and are often considered to be a pest.

The pupa is green at first, gradually darkening to black. The adults mate one or two days after emerging from the pupa and start laying eggs one to five days later. They die three to nineteen days after emergence.


References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!