Molecular Biology and Genetics

Molecular Biology

Barcode data: Drosophila cf. polychaeta SM-2007

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AAAGATATTGGAACTTTATATTTTATTTTTGGTGCTTGAGCAGGAATAGTGGGAACATCTCTA---AGAATTTTAATTCGAGCTGAATTAGGACATCCTGGAGCCTTAATTGGAGAT---GATCAAATTTATAATGTTATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTTGGAAATTGACTTGTTCCTCTTATA---TTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGTTTTTGACTTTTACCCCCAGCTCTAACTCTTTTATTAGTAAGAAGTATAGTAGAAAGTGGAGCAGGAACAGGTTGAACTGTTTACCCTCCTCTTTCAGCAGGAATTGCACATGGAGGAGCTTCTGTCGATTTA---GCAATTTTTTCCCTTCATTTAGCTGGAATTTCTTCTATTTTAGGAGCAGTAAATTTTATTACAACAGTAATTAATATACGATCTTCTGGAATTACATTTGATCGAATACCTTTATTTGTATGATCAGTTGTAATTACTGCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Drosophila cf. polychaeta SM-2007

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Drosophila cf. clefta BCW-2006

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTTCTACAAATCATAAAGATATTGGAACATTATATTTTATCTTTGGAGCATGAGCAGGAATAGTAGGTACATCTTTGAGAATTTTAATCCGAGCAGAACTGGGACACCCAGGAGCTTTAATTGGAGAT---GATCAAATTTATAATGTTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGACTGGTACCATTAATGCTAGGAGCACCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGATTATTGCCTCCAGCCCTTTCTCTTTTATTGGTCAGAAGAATAGTGGAAAACGGAGCTGGTACAGGTTGAACAGTTTACCCTCCGCTATCATCTGGGATTGCTCATGGAGGAGCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATCTCTTCTATTTTAGGGGCTGTAAATTTTATTACTACAGTTATTAATATACGATCTTCAGGTATTTCTCTTGATCGAATACCTTTATTTGTTTGATCTGTTGTAATTACTGCATTATTACTTCTTTTATCTTTACCAGTTTTAGCAGGGGCTATCACAATATTATTAACAGATCGAAATCTTAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATCTTATATCAACACTTATTTTGATTCTTTGGACACCCAGAAGTCTATATTTTAATTTTACCTGGATTTGGAATGATTTCACATATTATTAGACAAGAATCGGGTAAAAAGGAAACTTTTGGGGCTCTAGGAATGATTTATGCTATGTTAGCAATTGGATTACTAGGTTTTATTGTTTGAGCTCATCATATATTTACAGTAGGTATAGATGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Drosophila cf. clefta BCW-2006

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Drosophila cf. cheda BCW-2006

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTTCAACAAATCATAAAGATATCGGAACTTTATACTTTATTTTTGGAGCTTGAGCAGGAATAGTTGGTACGTCTCTAAGAATTTTAATTCGAGCAGAACTAGGACACCCAGGAGCTTTAATTGGAGAT---GATCAAATTTATAACGTTATTGTTACAGCTCACGCTTTCGTAATGATTTTTTTTATAGTAATACCTATTATAATTGGAGGGTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTATTACCTCCTGCCCTTACTCTTTTATTAGTCAGAAGAATAGTAGAAAACGGGGCTGGAACAGGATGAACAGTTTACCCTCCTTTATCGGCAGGAATCGCTCACGGAGGAGCTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCTTCCATTCTTGGAGCCGTAAATTTTATTACAACTGTAATTAATATACGGTCTACAGGGATTACTCTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGCTTTATTACTACTTTTATCACTTCCTGTTTTAGCAGGGGCTATCACTATACTATTAACAGATCGAAACTTAAATACATCATTTTTTGACCCAGCTGGAGGGGGTGACCCTATCTTATACCAACACTTATTTTGATTTTTTGGACACCCAGAAGTTTATATTTTAATTATTCCTGGATTTGGAATAATTTCTCATATTATTAGCCAAGAATCAGGTAAAAAAGAAACCTTTGGATCTTTAGGAATAATTTATGCAATATTAGCAATTGGATTATTAGGATTTATTGTCTGAGCTCATCATATATTTACAGTTGGGATAGATGTTGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Drosophila cf. cheda BCW-2006

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:3,850Public Records:1,518
Specimens with Sequences:4,116Public Species:346
Specimens with Barcodes:3,494Public BINs:174
Species:509         
Species With Barcodes:423         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Drosophila

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Drosophila (subgenus)

The paraphyletic subgenus Drosophila of the genus Drosophila was first described by Alfred Sturtevant in 1939.[1]

Phylogeny



 immigrans-tripunctata radiation





 D. quadrilineata species group



 Samoaia





 Zaprionus




 D. tumiditarsus species group



 Liodrosophila








 Dichaetophora



 Hirtodrosophila




 Mycodrosophila



 Paramycodrosophila







 virilis-repleta radiation (in part)




 subgenus Siphlodora



 virilis-repleta radiation (in part)






 Hawaiian Drosophila



 Scaptomyza




 D. polychaeta species group



Most species are within three major groups, the virilis-repleta radiation, the immigrans-tripunctata radiation and the Hawaiian Drosophila. Additionally, several smaller species groups are recognized consisting of smaller number of species, like the tumiditarsus species group and the polychaeta species group.

References

  1. ^ Sturtevant, A. H. (1939). On the subdivision of the genus Drosophila. Proceedings of the National Academy of Sciences of the United States of America 25, 137–141.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Drosophila


Drosophila!<-- This template has to be "warmed up" before it can be used, for some reason -->

Drosophila is a genus of small flies, belonging to the family Drosophilidae, whose members are often called "fruit flies" or more appropriately (though less frequently) pomace flies, vinegar flies, or wine flies, a reference to the characteristic of many species to linger around overripe or rotting fruit. They should not be confused with the Tephritidae, a related family, which are also called fruit flies (sometimes referred to as "true fruit flies"); tephritids feed primarily on unripe or ripe fruit, with many species being regarded as destructive agricultural pests, especially the Mediterranean fruit fly. One species of Drosophila in particular, D. melanogaster, has been heavily used in research in genetics and is a common model organism in developmental biology. Indeed, the terms "fruit fly" and "Drosophila" are often used synonymously with D. melanogaster in modern biological literature. The entire genus, however, contains more than 1,500 species[1] and is very diverse in appearance, behavior, and breeding habitat.

Contents

Name

The term "Drosophila", meaning "dew-loving", is a modern scientific Latin adaptation from Greek words δρόσος, drósos, "dew", and φίλος, phílos, "loving" with the Latin feminine suffix -a. On occasion, the name is misspelled as "drosophilia".

Morphology

Side view of head showing characteristic bristles above the eye

Drosophila are small flies, typically pale yellow to reddish brown to black, with red eyes. Many species, including the noted Hawaiian picture-wings, have distinct black patterns on the wings. The plumose (feathery) arista, bristling of the head and thorax, and wing venation are characters used to diagnose the family. Most are small, about 2–4 millimetres long, but some, especially many of the Hawaiian species, are larger than a house fly.

Life cycle and ecology

Habitat

Drosophila are found all around the world, with more species in the tropical regions. They can be found in deserts, tropical rainforest, cities, swamps, and alpine zones. Some northern species hibernate. Most species breed in various kinds of decaying plant and fungal material, including fruit, bark, slime fluxes, flowers, and mushrooms. The larvae of at least one species, D. suzukii, can also feed in fresh fruit and can sometimes be a pest.[2] A few species have switched to being parasites or predators. Many species can be attracted to baits of fermented bananas or mushrooms, but others are not attracted to any kind of baits. Males may congregate at patches of suitable breeding substrate to compete for the females, or form leks, conducting courtship in an area separate from breeding sites.

Several Drosophila species, including D. melanogaster, D. immigrans, and D. simulans, are closely associated with humans, and are often referred to as domestic species. These and other species (D. subobscura, Zaprionus indianus[3][4][5]) have been accidentally introduced around the world by human activities such as fruit transports.

Reproduction

Life cycle of Drosophila

Egg
Larva
Pupae (brown examples are older than the white ones)

Males of this genus are known to have the longest sperm cells of any organism on Earth, including one species, Drosophila bifurca, that has sperm 58 mm (2.3 in) long.[6] The cells are mostly tail, and are delivered to the females in tangled coils. The other members of the genus Drosophila also make relatively few giant sperm cells, with that of D. bifurca being the longest.[7] D. melanogaster sperm cells are a more modest 1.8 mm long, although this is still about 300 times longer than a human sperm. Several species in the D. melanogaster species group are known to mate by traumatic insemination.[8]

Drosophila vary widely in their reproductive capacity. Those such as D. melanogaster that breed in large, relatively rare resources have ovaries that mature 10–20 eggs at a time, so that they can be laid together on one site. Others that breed in more-abundant but less nutritious substrates, such as leaves, may only lay one egg per day. The eggs have one or more respiratory filaments near the anterior end; the tips of these extend above the surface and allow oxygen to reach the embryo. Larvae feed not on the vegetable matter itself but on the yeasts and microorganisms present on the decaying breeding substrate. Development time varies widely between species (between 7 and more than 60 days) and depends on the environmental factors such as temperature, breeding substrate, and crowding.

Laboratory–cultured animals

Drosophila melanogaster is a popular experimental animal because it is easily cultured in mass out of the wild, has a short generation time, and mutant animals are readily obtainable. In 1906, Thomas Hunt Morgan began his work on D. melanogaster and reported his first finding of a white (eyed) mutant in 1910 to the academic community. He was in search of a model organism to study genetic heredity and required a species that could randomly acquire genetic mutation that would visibly manifest as morphological changes in the adult animal. His work on Drosophila earned him the 1933 Nobel Prize in Medicine for identifying chromosomes as the vector of inheritance for genes. This and other Drosophila species are widely used in studies of genetics, embryogenesis, and other areas.

However, some species of Drosophila are difficult to culture in the laboratory, often because they breed on a single specific host in the wild. For some it can be done with particular recipes for rearing media, or by introducing chemicals such as sterols that are found in the natural host; for others it is (so far) impossible. In some cases, the larvae can develop on normal Drosophila lab medium but the female will not lay eggs; for these it is often simply a matter of putting in a small piece of the natural host to receive the eggs. The Drosophila Stock Center in San Diego maintains cultures of hundreds of species for researchers.

Predators

Drosophila are prey for many generalist predators such as robber flies. In Hawaii, the introduction of yellowjackets from the mainland United States has led to the decline of many of the large species. The larvae are preyed on by other fly larvae, staphylinid beetles, and ants.

Systematics

D. setosimentum, a species of Hawaiian picture-wing fly
 




 immigrans-tripunctata radiation





 D. quadrilineata species group



 Samoaia





 Zaprionus




 D. tumiditarsus species group



 Liodrosophila








 Dichaetophora



 Hirtodrosophila




 Mycodrosophila



 Paramycodrosophila







 virilis-repleta radiation (in part)




 subgenus Siphlodora



 virilis-repleta radiation (in part)






 Hawaiian Drosophila



 Scaptomyza




 D. polychaeta species group





 Dorsilopha





 Old World Sophophora




 New World Sophophora



 Lordiphosa



 Hirtodrosophila duncani




The genus Drosophila as currently defined is paraphyletic (see below) and contains 1450 described species,[1][9] while the estimated total number of species is estimated at thousands.[10] The majority of the species are members of two subgenera: Drosophila (~1,100 species) and Sophophora (including D. (S.) melanogaster; ~330 species). The Hawaiian species of Drosophila (estimated to be more than 500, with ~380 species described) are sometimes recognized as a separate genus or subgenus, Idiomyia,[1][11] but this is not widely accepted. About 250 species are part of the genus Scaptomyza, which arose from the Hawaiian Drosophila and later re-colonized continental areas.

Evidence from phylogenetic studies suggests that the following genera arose from within the genus Drosophila:[12][13]

Several of the subgeneric and generic names are based on anagrams of Drosophila, including Dorsilopha, Lordiphosa, Siphlodora, Phloridosa and Psilodorha.

Further information: List of Drosophila species

Drosophila species genome project

Drosophila are extensively used as a model organism in genetics (including population genetics), cell-biology, biochemistry, and especially developmental biology. Therefore, extensive efforts are made to sequence drosphilid genomes. The genomes of the following species have been fully or partially sequenced so far:[14]

The data will be used for many purposes, including evolutionary genome comparisons. D. simulans and D. sechellia are sister species, and provide viable offspring when crossed, while D. melanogaster and D. simulans produce infertile hybrid offspring. The Drosophila genome is often compared with the genomes of more distantly related species such as the honeybee Apis mellifera or the mosquito Anopheles gambiae.

Curated data are available at FlyBase.

References

  1. ^ a b c Gerhard Bächli (1999–2006). "TaxoDros: the database on taxonomy of Drosophilidae". http://www.taxodros.uzh.ch/. 
  2. ^ Mark Hoddle. "Spotted Wing Drosophila (Cherry Vinegar Fly) Drosophila suzukii". Center for Invasive Species Research. http://cisr.ucr.edu/spotted_wing_drosophila_cherry_vinegar_fly.html. Retrieved July 29, 2010. 
  3. ^ C. R. Vilela (1999). "Is Zaprionus indianus Gupta, 1970 (Diptera, Drosophilidae) currently colonizing the Neotropical region?". Drosophila Information Service 82: 37–39. 
  4. ^ Kim van der Linde, Gary J. Steck, Ken Hibbard, Jeffrey S. Birdsley, Linette M. Alonso & David Houle (2006). "First records of Zaprionus indianus (Diptera, Drosophilidae), a pest species on commercial fruits, from Panama and the United States of America". Florida Entomologist 89 (3): 402–404. doi:10.1653/0015-4040(2006)89[402:FROZID]2.0.CO;2. 
  5. ^ S. Castrezana (2007). "New records of Zaprionus indianus Gupta, 1970 (Diptera, Drosophilidae) in North America and a key to identify some Zaprionus species deposited in the Drosophila Tucson Stock Center". Drosophila Information Service 90: 34–36. 
  6. ^ Scott Pitnick, Greg S. Spicer & Therese A. Markow (1995). "How long is a giant sperm?". Nature 375 (6527): 109. doi:10.1038/375109a0. PMID 7753164. 
  7. ^ Dominique Joly, Nathalie Luck & Béatrice Dejonghe (2007). "Adaptation to long sperm in Drosophila: correlated development of the sperm roller and sperm packaging". Journal of Experimental Zoology B: Molecular and Developmental Evolution 310B (2): 167–178. doi:10.1002/jez.b.21167. PMID 17377954. 
  8. ^ Kamimura, Yoshitaka (2007-08-22). "Twin intromittent organs of Drosophila for traumatic insemination". Biol Lett. (The Royal Society) 3 (4): 401–404. doi:10.1098/rsbl.2007.0192. PMID 17519186. 
  9. ^ Therese A. Markow & Patrick M. O'Grady (2005). Drosophila: A guide to species identification and use. London: Elsevier. ISBN 0124730523. 
  10. ^ Colin Patterson (1999). Evolution. Cornell University Press. ISBN 0801485940. 
  11. ^ Irina Brake & Gerhard Bächli (2008). Drosophilidae (Diptera). World Catalogue of Insects. pp. 1–412. ISBN 9788788757880. 
  12. ^ Patrick O'Grady & Rob DeSalle (2008). "Out of Hawaii: the origin and biogeography of the genus Scaptomyza (Diptera: Drosophilidae)". Biology Letters 4 (2): 195–199. doi:10.1098/rsbl.2007.0575. PMID 18296276. 
  13. ^ James Remsen & Patrick O'Grady (2002). "Phylogeny of Drosophilinae (Diptera: Drosophilidae), with comments on combined analysis and character support". Molecular Phylogenetics and Evolution 24 (2): 249–264. doi:10.1016/S1055-7903(02)00226-9. PMID 12144760. 
  14. ^ "12 Drosophila Genomes Project". Lawrence Berkeley National Laboratory. http://rana.lbl.gov/drosophila/index.html. Retrieved July 29, 2010. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!