Articles on this page are available in 1 other language: Arabic (13) (learn more)

Overview

Comprehensive Description

General Description

A large (5.9-6.5 cm wingspan) moth with dark blackish forewings and deep red-orange hindwings. The forewings are dark grey with a few patches of pale scales, in particular before and below the reniform and along the subterminal line. There is a diffuse band or patch of paler scales, some of which are brown, inside of the subterminal band. The hindwings are deep red-orange, crossed by a complete black median and a wider black terminal band. The hindwing fringe is white. The antennae are simple, and the sexes are similar. The contrasting pale patch and brown scaling on the outer half of the forewings is diagnostic of briseis.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Across the Boreal forest region from Newfoundland to the Pacific, south to Massachusetts and Pennsylvania. In the west, replaced southward in the mountains by the similar but larger C. groteiana. In Alberta, it is one of the most common and widespread Catocala species. Occurs across the Aspen parkland and Boreal forest region, north almost to Lake Athabasca. It is also found in lower elevations of the mountains, the Cypress Hills and wooded parts of the Grasslands region.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Mature hardwood and mixedwood forest, and in particular aspen forest.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

No Alberta data. Elsewhere the larvae have been reported to feed on poplars (Populus) and willows (Salix). There is some evidence to suggest that willow may be a preferred hostplant.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Adults are on the wing from the end of July through late September.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Adults are nocturnal and come to light, but they are best collected using sugar baits. They emerge in late summer and early fall and produce the eggs which overwinter. The larvae are solitary defoliators.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Catocala briseis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACTTTATACTTTATTTTTGGAATTTGAGCCGGGATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGACTTCTACCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTACCCCCCTCTTTCTTCCAATATTGCTCATAGAGGTAGTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTAATATTTGATCAGATACCTTTATTTATTTGAGCTGTTGGAATTACTGCATTTCTTCTTCTTCTTTCTTTACCAGTATTAGCTGGAGCTATTACCATACTTCTAACTGATCGAAATTTAAACACTTCTTTTTTCGATCCTGCGGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Catocala briseis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Catocala briseis sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

A common, widespread insect. No concerns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© University of Alberta Museums

Source: University of Alberta Museums

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Catocala briseis

The Briseis Underwing or Ribbed Underwing (Catocala briseis) is a moth of the Noctuidae family. It is found across the Boreal forest region from Newfoundland to the Pacific, south to Massachusetts and Pennsylvania.

The wingspan is 59-65 mm. Adults are on wing from July to September depending on the location.

The larvae feed on Populus species, including Populus tremuloides and Salix species.

Subspecies

Catocala briseis minerva, recorded from Utah, is now considered a synonym.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!