Molecular Biology and Genetics

Molecular Biology

Barcode data: Pyrausta purpuralis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATTTTTGGAATTTGAAGAAGAATAGTAGGAACTTCATTAAGTCTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTTAATTGGAGATGATCAAATCTATAATACTATTGTTACAGCACATGCATTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGGTTTGGAAATTGATTAGTACCCCTCATATTAGGAGCTCCAGATATAGCTTTCCCACGAATAAATAATATAAGATTCTGATTACTCCCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCCCTCTTTCCTCAAATATTGCACATGGGGGAAGCTCAGTAGACTTAGCCATTTTCTCCTTACATTTAGCTGGAATTTCTTCTATTCTTGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAATGGAATATCATTCGATCAAATACCATTATTTGTGTGAGCTGTAGGAATTACAGCTTTACTTTTACTACTATCCCTTCCTGTTTTAGCAGGAGCCATTACCATACTACTTACTGATCGAAATTTAAATACATCCTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pyrausta purpuralis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pyrausta purpuralis

Pyrausta purpuralis is a species of moth of the family Crambidae. It is found in Europe. The species closely resembles Pyrausta aurata.

IKAl 20100804 Schmetterling.jpg

The wingspan is ca. 20 mm. The moth flies from May to September depending on the location. The species is active during the day.

The larvae feed on Mint.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!