Ecology

Habitat

Depth range based on 1003 specimens in 23 taxa.
Water temperature and chemistry ranges based on 362 samples.

Environmental ranges
  Depth range (m): -2.2 - 838
  Temperature range (°C): -1.434 - 19.740
  Nitrate (umol/L): 0.916 - 33.078
  Salinity (PPS): 8.500 - 35.458
  Oxygen (ml/l): 3.466 - 8.218
  Phosphate (umol/l): 0.091 - 2.547
  Silicate (umol/l): 0.981 - 73.441

Graphical representation

Depth range (m): -2.2 - 838

Temperature range (°C): -1.434 - 19.740

Nitrate (umol/L): 0.916 - 33.078

Salinity (PPS): 8.500 - 35.458

Oxygen (ml/l): 3.466 - 8.218

Phosphate (umol/l): 0.091 - 2.547

Silicate (umol/l): 0.981 - 73.441
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:161Public Records:6
Specimens with Sequences:59Public Species:6
Specimens with Barcodes:59Public BINs:1
Species:8         
Species With Barcodes:7         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Urticina sp. Reversing Falls miniature

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTTGGAATAGGATCCGGTATGATAGGCACAGCTTTAAGTATGTTAATAAGATTGGAATTATCTGCCCCTGGTACTATGTTGGGGGAT---GACCATCTTTATAATGTCATAGTGACGGCACACGCCTTTATTATGATTTTCTTCCTAGTAATGCCAGTAATGATAGGAGGGTTTGGTAATTGGTTGGTACCACTATACATTGGTGCCCCCGATATGGCCTTCCCACGACTAAACAATATTAGTTTTTGGCTACTTCCTCCCGCGCTTATACTATTACTAGGTTCTGCCTTTGTTGAGCAAGGAGTGGGAACAGGGTGGACGGTATACCCTCCTCTATCCGGCATTCAAACGCACTCGGGAGGGGCGGTCGACATGGCCATCTTTAGCCTTCATTTAGCGGGTGCGTCTTCTATATTAGGGGCAATGAATTTTATAACAACCATATTTAATATGAGAGCACCGGGATTAACGATGGATAGACTCCCGCTATTTGTGTGGTCCATTTTAATTACTGCCTTTTTATTATTACTCTCCCTACCAGTCTTAGCAGGTGGAATAACCATGCTTTTAACAGATAGGAATTTTAATACAACTTTCTTTGACCCAGCAGGAGGTGGAGATCCCATCTTATTCCAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Urticina sp. Reversing Falls miniature

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Urticina

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Urticina

Urticina is a genus of sea anemones in the family Actiniidae.

Species[edit]

The following species are listed in the World Register of Marine Species (WoRMS): [1]

References[edit]

  1. ^ a b Urticina Ehrenberg, 1834 World Register of Marine Species. Retrieved 2011-08-31.
  2. ^ Urticina coriacea (Red beaded anemone), WSU BeachWatchers
  3. ^ Urticina crassicornis (Christmas anemone), WSU BeachWatchers
  4. ^ Urticina lofotensis (White spotted anemone), WSU BeachWatchers
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!