Molecular Biology and Genetics

Molecular Biology

Barcode data: Catocala amatrix

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCACTAAGATTATTAATTCGAGCCGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATCATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCCCGTATAAATAATATAAGTTTTTGACTTCTCCCCCCTTCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTATATCCCCCTCTTTCTTCTAATATTGCTCATAGAGGTAGTTCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCTTCAATCTTAGGGGCTATTAATTTTATTACCACAATTATTAATATACGATTAAATAATTTAATATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACTGCATTTCTTCTTCTTCTTTCACTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catocala amatrix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Catocala amatrix

The Sweetheart Underwing (Catocala amatrix) is a moth of the Noctuidae family. The species can be found from Nova Scotia, south through Connecticut to Florida and west through Texas and Oklahoma to Arizona and north to Montana, Minnesota, and Ontario.

An exhibition model done by the Denton Brothers of Wellesley, Massachusetts was discovered in a consignment shop in Flagler Beach, Florida on September 12, 2013 by Brittany Durocher, a resident of that city. It was collected by the Denton Brothers in Virginia and named Catocala amatrix virginurus.

picture of the specimen found by Ms. Durocher
Attribution to the Denton Brothers
Catocala amatrix 2154069.jpg
Lectotype of Catocala nurus, now considered to be a synonym of Catocala amatrix

The wingspan is 75–95 mm. The moths flies from August to October depending on the location.

The larvae feed on Populus deltoides, Populus grandidenta, Populus nigra, Populus tremuloides, and Salix nigra.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!