Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 402 - 402
  Temperature range (°C): 12.899 - 12.899
  Nitrate (umol/L): 20.002 - 20.002
  Salinity (PPS): 35.673 - 35.673
  Oxygen (ml/l): 3.259 - 3.259
  Phosphate (umol/l): 0.875 - 0.875
  Silicate (umol/l): 12.028 - 12.028
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 3 taxa.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 556 - 1818
  Temperature range (°C): 11.597 - 11.597
  Nitrate (umol/L): 16.281 - 16.281
  Salinity (PPS): 35.791 - 35.791
  Oxygen (ml/l): 4.332 - 4.332
  Phosphate (umol/l): 0.885 - 0.885
  Silicate (umol/l): 6.507 - 6.507

Graphical representation

Depth range (m): 556 - 1818
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 23.4582 - 55.8018
  Temperature range (°C): 25.391 - 25.391
  Nitrate (umol/L): 1.129 - 1.129
  Salinity (PPS): 35.279 - 35.279
  Oxygen (ml/l): 4.634 - 4.634
  Phosphate (umol/l): 0.083 - 0.083
  Silicate (umol/l): 0.777 - 0.777

Graphical representation

Depth range (m): 23.4582 - 55.8018
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records: 11
Specimens with Sequences: 7
Specimens with Barcodes: 7
Species: 7
Species With Barcodes: 4
Public Records: 2
Public Species: 2
Public BINs: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Epitonium cf. jukesianum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTCTTGCTATTGTCCTCAGGGGCTGTAGAAAGAGGAGTGGGGACTGGGTGAACTGTGTACCCACCATTATCAGGCAATTTAGCTCATAGCGGTGGTTCGGTCGACTTGGCTATTTTTTCTTTGCATTTAGCTGGAGCTTCTTCGATTTTGGGAGCAGTGAATTTTATTACTACTATTATAAATATACGATGACGAGGTATACAATTAGAACGAATGCCTCTATTCGTGTGATCGGTAAAAATTACAGCTATTTTGCTGTTATTATCTTTACCAGTATTGGCAGGAGCTATTACAATATTATTAACGGATCGTAATTTTAATACATCATTTTTTGATCCTGCTGGTGGGGGGGACCCTATTTTATACCAACATCTGTTTTGATTTTTCGGGCACCCCGAAGTATATATTTTAATTTTACCAGGATTTGGTATAATTTCTCACATTGTTAGCCACTATTCTTGTAAAAAAGAAACATTTGGGACTTTAGGAATAATCTATGCAATACTATCAATTGGTATTCTTGGGTTTATTGTTTGAGCACATCATATATTTACAGTTGGGATAGATGTTGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Epitonium cf. jukesianum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Epitonium

Epitonium is a genus of small predatory sea snails, marine gastropod mollusks. Epitonium is the type genus of the family Epitoniidae, the wentletraps.[1]

The common name wentletraps is derived from the Dutch word wenteltrap, denoting a spiral staircase. This refers to the striking form and sculpture of the shells of the mollusks in this genus, and to a lesser extent, the whole family.

The genus Epitonium has been divided in the past by some authors into several subgenera, but these subgenera were based only on shell characters and did not reflect the true underlying relationships or phylogeny.

Shell description[edit]

Epitonium shells are high-spired, and are all-white in most of the species within this genus. A few species are tinted with brown to varying degrees, or have a brown stripe on the shoulder of the whorl. The shells typically have blade-like vertical ribs, known as costae.

Habitat[edit]

Wentletraps usually live in sand near sea anemones or corals.

Life habits[edit]

These snails are predators and feed by inserting their proboscis and biting out small pieces of the anemone's tissues. Some species of wentletrap feed on only one species of sea anemone, in other words they are species-specific in terms of their prey.

Synonymised genera[edit]

Many species that now are placed in the genus Epitonium have, over the years, been classified in other genera. These have become synonyms of Epitonium :[1]

  • Aciona Leach, 1815
  • Acutiscala de Boury, 1909
  • Amiciscala Jousseaume, 1912
  • Anguliscala de Boury, 1909
  • Avalitiscala de Boury, 1912
  • Cirratiscala de Boury, 1909 )
  • Connexiscala de Boury, 1909
  • Crenuliscala Iredale, 1936
  • Crisposcala de Boury, 1886
  • Cyclostoma Lamarck, 1799
  • Delicatiscala de Boury, 1909
  • Dulciscala de Boury, 1909
  • Eburniscala de Boury, 1909
  • Epitonium (Clathrus)
  • Evolutiscala de Boury, 1909
  • Firmiscala de Boury, 1909
  • Folaceiscala de Boury, 1912
  • Foraceiscala de Boury, 1911
  • Foveoscala de Boury, 1909
  • Fusicoscala Monterosato, 1890
  • Glabriscala de Boury, 1909
  • Graciliscala de Boury, 1909
  • Gradatiscala de Boury, 1909
  • Hirtoscala Monterosato, 1890
  • Hyaloscala de Boury, 1890
  • Innesiscala Jousseaume, 1912
  • Janthoscala Mörch, 1875
  • Labeoscala de Boury, 1912
  • Laeviscala de Boury, 1909
  • Lamelliscala de Boury, 1909
  • Lepidiscala de Boury, 1909
  • Limiscala de Boury, 1909
  • Limniscala Dollfus, 1913
  • Linctoscala Monterosato, 1890
  • Lineoscala de Boury, 1909
  • Mazescala Iredale, 1936
  • Melanopsis Férussac, 1807
  • Minutiscala de Boury, 1909
  • Nipponoscala Masahito & Habe, 1973
  • Nitidiscala de Boury, 1909
  • Nitidoscala Strong, 1930
  • Papyriscala de Boury, 1909
  • Parviscala de Boury, 1887
  • Perlucidiscala de Boury, 1912
  • Pudentiscala Iredale, 1938
  • Pupiscala Masahito, Kuroda & Habe, 1971
  • Resticuliscala Cossmann, 1912
  • Reticuliscala de Boury, 1909
  • Scala Mörch, 1852
  • Scalaria Lamarck, 1801
  • Scalarus Montfort, 1810 (Unjustified emendation of Scalaria)
  • Scalatarius Duméril, 1806
  • Sodaliscala de Boury, 1909
  • Sphaeroscala Monterosato, 1890
  • Spiniscala de Boury, 1909
  • Turbiniscala de Boury, 1909
  • Viciniscala de Boury, 1909

Species[edit]

Epitonium irregulare

Species within the genus Epitonium include:

Note: Some malacologists have recently placed many of the more than 600 named species into other genera, which were previously considered to be subgenera of the genus Epitonium. On the other hand, many species that belonged to subgenera of Epitonium are now included in Epitonium. These subgenera were based on details of the shell sculpture and not on molecular analysis.

Species brought into synonymy

See also[edit]

References[edit]

  1. ^ a b Bouchet, P.; Gofas, S. (2010). Epitonium Röding, 1798. In: Bouchet, P.; Gofas, S.; Rosenberg, G. (2010) World Marine Mollusca database. Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=137943 on 2010-11-22
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!