Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 297 specimens in 19 taxa.
Water temperature and chemistry ranges based on 100 samples.

Environmental ranges
  Depth range (m): 0 - 1253
  Temperature range (°C): 2.894 - 29.212
  Nitrate (umol/L): 0.099 - 44.010
  Salinity (PPS): 32.580 - 37.969
  Oxygen (ml/l): 0.542 - 6.453
  Phosphate (umol/l): 0.006 - 3.268
  Silicate (umol/l): 0.380 - 151.324

Graphical representation

Depth range (m): 0 - 1253

Temperature range (°C): 2.894 - 29.212

Nitrate (umol/L): 0.099 - 44.010

Salinity (PPS): 32.580 - 37.969

Oxygen (ml/l): 0.542 - 6.453

Phosphate (umol/l): 0.006 - 3.268

Silicate (umol/l): 0.380 - 151.324
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
Specimen Records:62
Specimens with Sequences:44
Specimens with Barcodes:36
Species:14
Species With Barcodes:13
Public Records:31
Public Species:13
Public BINs:16
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Aplysia cf. juliana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

AGTCTCTTAATTCGATTTGAGCTTGGTACTGCTGGAGCCTTCTTAGGAGAT---GATCATTTTTACAATGTAATTGTAACTGCTCATGCTTTTGTAATGATTTTTTTCATGGTTATGCCTATTATAATTGGTGGGTTCGGAAACTGAATGGTACCTTTATTAATTGGTGCTCCTGATATGAGATTCCCTCGTATAAATAACATAAGTTTTTGACTTCTCCCTCCTTCCTTTTTGCTTCTTTTAGTTTCTAGATTAATAGAAGGTGGAGCTGGGACAGGGTGGACGGTATACCCCCCTTTGTCGGGTCCTATTGCCCATGGAGGTACCTCTGTTGATCTGGCTATTTTTTCCCTTCATTTGGCGGGGATGTCCTCAATTTTAGGTGCCATTAACTTCATTACTACAATTTTTAATATACGTTCACCAGGAATTACTTTCGAGCGGCTCAGTTTATTTGTATGGTCTGTACTAGTAACAGCTTTTTTACTGTTACTTTCCTTACCTGTTTTAGCTGGTGCTATTACAATGCTTTTAACTGATCGTAATTTTAATACTAGTTTCTTCGATCCTGCTGGGGGAGGAGATCCTATTTTATACCAACACTTGTTCTGGTTCTTTGGACATCCAGAGGTATATATTCTAATTTTACCTGGGTTTGGGATAATTTCTCATATTCTGAGTAATTTCTCT---TCTAAGCCAGCATTTGGAACTTTAGGAATAATTTACGCTATAATTTCTATTGGAATTTTAGGTTTCATTGTGTGGGCTCATCATATGTTTACTGTGGGAATGGATGTAGATACTCGAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aplysia cf. juliana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Museum of Tropical Queensland and Queensland Museum
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Aplysia

Aplysia is a genus of medium-sized to extremely large sea slugs, specifically sea hares, which are one clade of large sea slugs, marine gastropod mollusks. The general description of sea hares can be found in the article on the superfamily Aplysioidea.

These benthic herbivorous sea hares can become rather large compared with most other mollusks. They graze in tidal and subtidal zones of tropical waters, mostly in the Indo-Pacific Ocean (23 species); but they can also be found in the Atlantic Ocean (12 species), with a few species occurring in the Mediterranean.

Aplysia species, when threatened, mostly release clouds of ink to blind the attacker. Following the lead of Eric R. Kandel, the genus has been studied as a model organism by neurobiologists, because its siphon-withdrawal response, as studied in Aplysia californica, is mediated by electrical synapses, which allow several neurons to fire synchronously (Kandel et al., 2000). (See : Aplysia gill and siphon withdrawal reflex) This quick neural response is necessary for a speedy reaction to danger by the animal. Aplysia has only about 20,000 neurons, making it a favorite subject for investigation by neuroscientists.[1] Also, the 'tongue' on the underside is controlled by only two neurons, which allowed complete mapping of the innervation network to be carried out.

Species[edit]

Species within the genus Aplysia are as follows. This list follows the studies of Medina et al. who established a phylogenetic hypothesis for the genus Aplysia through study of the partial mitochondrial DNA (mtDNA) sequence data of ribosomal genes (rDNA).

An Aplysia fasciata (above) and a couple of Aplysia punctata (below) grazing in a tide pool in Póvoa de Varzim, Portugal.
  • Aplysia argus Rüppell & Leuckart, 1830
  • Aplysia californica (J.G. Cooper, 1863) California sea hare
    • Distribution : Northeast Pacific
  • Aplysia cedrocensis (Bartsch & Rehder, 1939)
    • Distribution : Northeast Pacific
  • Aplysia cervina (Dall & Simpson, 1901)
    • Distribution : West Atlantic
  • Aplysia cornigera Sowerby, 1869
    • Distributuion: Indian Ocean, West Pacific
  • Aplysia cronullae Eales, 1960
    • Distribution : Southwest Pacific
  • Aplysia dactylomela (Rang, 1828) Spotted sea hare
    • Distribution : Cosmopolitan; tropical and temperate seas.
    • Color : from pale gray to green to dark brown.
    • Description : large black rings on the mantle; good swimmer
  • Aplysia denisoni Smith, 1884
    • Distribution : Indian Ocean, West Pacific
  • Aplysia depilans (Gmelin, 1791)
    • Distribution : Northeast Atlantic, Mediterranean.
    • Description : thin, yellow inner shell
  • Aplysia dura Eales, 1960
    • Distribution : Southeast Atlantic, Southwest Pacific
  • Aplysia euchlora Adams in M.E.Gray, 1850
    • Distribution : Northwest Pacific
  • Aplysia extraordinaria (Allan, 1932) (possibly = Aplysia gigantea)
    • Distribution : Western Australia, New Zealand.
    • Length : more than 40 cm
  • Aplysia fasciata (Poiret, 1798) ( Aplysia brasiliana Rang, 1828 is a junior synonym).
    • Distribution : East Atlantic, Mediterranean, West Africa, Red Sea
    • Length : 40 cm
    • Color : dark brown to black.
    • Description : sometimes has a red border to the parapodia and oral tentacles;
  • Aplysia gigantea Sowerby, 1869
    • Distribution : Indian Ocean, West Pacific
  • Aplysia gracilis Eales, 1960 [citation needed]
    • Distribution : Red Sea
  • Aplysia inca d'Orbigny, 1837
    • Distribution : Southeast Pacific
  • Aplysia juliana (Quoy & Gaimard, 1832) Walking sea hare
    • Distribution: cosmopolitan, circumtropical in all warm seas
    • Color: various, from uniform to pale brown
    • Description: no purple gland, therefore no ink secretions; posterior end of the foot can act as a sucker
  • Aplysia keraudreni Rang, 1828
    • Distribution: South Pacific
    • Length: 25 cm
    • Color: dark brown
  • Aplysia kurodai (Baba, 1937)
    • Distribution: NW Pacific
    • Length: 30 cm
    • Color: dark brown to purplish black, dotted with white spots
  • Aplysia maculata Rang, 1828
    • Distribution : Western Indian Ocean
  • Aplysia morio (A. E. Verrill, 1901) Atlantic black sea hare, sooty sea hare
    • Distribution: Northwest Atlantic
    • Length: 40 cm
    • Color: black to deep brown; no spots
  • Aplysia nigra d'Orbigny, 1837
    • Distribution : Southwest Atlantic, South Pacific
  • Aplysia nigra brunnea Hutton, 1875
    • Distribution: New Zealand
    • Length: 10 cm
    • Color: dark brown
  • Aplysia oculifera (Adams & Reeve, 1850) Spotted sea hare
    • Distribution: Indian Ocean; West Pacific; common along the north, east and south coast of South Africa
    • Length: 15 cm
    • Description: greenish brown, with small brown to black spots with white centres
    • Habitat: shallow bays and estuaries
    • Behaviour: hides by day; emerges at night to feed on seaweed
  • Aplysia parvula (Guilding in Moerch, 1863) Pygmy sea hare, Dwarf sea hare
    • Distribution : worldwide in warm to temperate seas
    • Length: 6 cm
    • Color: brown to green spots
  • Aplysia punctata (Cuvier, 1803)
    • Distribution: NE Atlantic
    • Length: 20 cm
    • Color: very variable
  • Aplysia rehderi Eales, 1960
    • Distribution : Northeast Pacific
  • Aplysia reticulata Eales, 1960
    • Distribution : Southwest Pacific
  • Aplysia reticulopoda (Beeman, 1960) Net-foot sea hare
    • Distribution : Northeast Pacific
  • Aplysia robertsi Pilsbry, 1895
    • Distribution : Northeast Pacific
  • Aplysia rudmani Bebbington, 1974
    • Distribution : Indian Ocean
  • Aplysia sagamiana (Baba, 1949)
    • Distribution: East Australia, Japan; Northwest Pacific
  • Aplysia sibogae (Bergh, 1905) (?)(probably = Aplysia juliana)
  • Aplysia sowerbyi Pilsbry, 1895
    • Distribution : Southwest Pacific
  • Aplysia sydneyensis (Sowerby, 1869)
    • Distribution: Australia
    • Length: 15 cm
    • Description: not clearly defined
  • Aplysia tanzanensis Bebbington, 1974
    • Distribution : Indian Ocean
  • Aplysia vaccaria (Winkler, 1955) California black sea hare (possibly  ?= Aplysia cedrocensis)
    • Distribution: Pacific Coast of California
    • Length: very big – up to 75 cm
    • Color: black
    • Description: no purple ink; huge internal shell
Species brought into synonymy

References[edit]

  1. ^ Redish, Edward F. (2003). "Chapter 2: Cognitive Principles and Guidelines for Instruction". Teaching Physics With The Physics Suite. Hoboken, New Jersey: John Wiley & Sons, Inc. p. 18. ISBN 978-0-471-39378-8. 
  • Howson, C.M.; Picton, B.E. (Ed.) (1997). The species directory of the marine fauna and flora of the British Isles and surrounding seas. Ulster Museum Publication, 276. The Ulster Museum: Belfast, UK. ISBN 0-948150-06-8. vi, 508 (+ cd-rom) pp
  • Gofas, S.; Le Renard, J.; Bouchet, P. (2001). Mollusca, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 180-213
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!