Overview

Brief Summary

Biology

The bulrush is a perennial species (3), which flowers in June and July (6); the seed heads begin to break up in autumn, and the downy seeds are dispersed by the wind (5). The bulrush colonises new sites in this way, after which it spreads by vegetative reproduction (3). The flowering spikes may persist until November (1). There have been very few uses of the bulrush in Britain, however in Nevada (USA) the Paiute Indians based their whole economy on this species; the yellow pollen was used as flour, and the stems and leaves were used to make boats (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The bulrush was termed 'reedmace' by botanists until the 1970s, but the common English name 'bulrush''has since been accepted (4). This robust species grows up to 2.5 m in height, and has linear leaves (2). The most characteristic feature of this plant, however, is the distinctive, dark brown busby-like flowering head (4), known as a 'spadix' (2). The individual flowers are tiny, closely packed and surrounded by slender hairs; female flowers, which produce seeds, are situated towards the bottom of the spadix, the male flowers are located towards the top, and in this species the male and female regions of the spadix are touching (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Comments

Common Cattail is a wetland species that most people are familiar with. Sometimes it hybridizes with Typha angustifolia (Narrow-Leaved Cattail), producing plants with characteristics that are intermediate between these two parents. Such plants are referred to Typha × glauca (Hybrid Cattail). Because the characteristics of Common Cattail, Narrow-Leaved Cattail, and Hybrid Cattail overlap with each other, it can be difficult to identify individual plants in the field. Generally, Common Cattail is larger in size with green to greyish blue leaves that span over ½' across. Its pistillate spikes are often ¾' across or more and they can exceed 1' in length. The staminate and pistillate spikes of Common Cattail are adjacent to each other or separated by less than ½'. Narrow-Leaved Cattail has slender green leaves that are ½' across or less. Its pistillate spikes are less than ¾' across and they are less than 1' in length. The staminate and pistillate spikes of Narrow-Leaved Cattail are separated from each other by more than ½' (usually by a few inches).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This native perennial plant is about 4-9' tall and unbranched, consisting of 6 or more leaves and a flowering stalk. This stalk is light green to green, glabrous, stiff, and round in cross-section (terete). The leaves are up to 7½' long and 1' across. They are linear, green to bluish grey (often the latter), hairless, and rather flattened. Relative to the flowering stalk, the leaves are erect to slightly spreading; they originate from the base of the plant. Some leaves have a tendency to flop downward toward their tips. Leaf venation is parallel. There is a sheath at the base of each leaf. The flowering stalk terminates in a spike of staminate flowers and a spike of pistillate flowers. The staminate spike is above the pistillate spike; they are adjacent or separated by ½' or less. The staminate spike is up to 1' long and less than ¾' across; it is narrowly cylindrical in shape, light yellow to light brown, and densely packed with staminate flowers and abundant hairs. Each staminate flower bears 4 grains of pollen; its petals and sepals are reduced to bristles. After the pollen is released, the staminate spike quickly withers away. The pistillate spike is is up to 1½' long and less than 1¼' across; it is cylindrical in shape, greenish to blackish brown, and densely packed with pistillate flowers and abundant hairs. Each fertile pistillate flower has a stipe at least 1 mm. long, a single achene, and a single style with a flattened stigma. The infertile pistillate flowers lack achenes, otherwise they are similar to the fertile pistillate flowers. The pistillate spike persists into the fall. The blooming period occurs during early to mid-summer. The root system produces thick starchy rhizomes and fibrous roots. Vegetative colonies are often produced.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

General: Cattail Family (Typhaceae). Cattails are herbaceous, rhizomatous perennial plants with long, slender green stalks topped with brown, fluffy, sausage-shaped flowering heads. Typha latifolia plants are 15-30 dm tall. The spike-like, terminal, cylindric inflorescence has staminate flowers above and pistillate flowers below with a naked axis between the staminate and pistillate flowers. The spike is green when fresh, becoming brown as it matures. The basal leaves are thin with parallel veins running the long, narrow length of the leaf. These plants are rhizomatous and colonial.

Public Domain

USDA NRCS National Plant Data Center & Idaho Plant Materials Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Alternative names

Flags, rushes, bulrushes, cat o’nine tails, Cossack asparagus, reed mace, baco (cattail)

Public Domain

USDA NRCS National Plant Data Center & Idaho Plant Materials Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

More info for the term: cover

Broadleaf cattail is a cosmopolitan species found in North America, Mexico, Great Britain, Eurasia, India, Africa, New Zealand, and Australia. In Canada, broadleaf cattail occurs in all provinces and the Northwest Territories [76]. In the United States, broadleaf cattail is native to all states except Hawaii, where it is introduced [212]. It also occurs in Puerto Rico; nativity to Puerto Rico is unknown [107]. Flora of North America provides a distributional map of broadleaf cattail.

Cattail hybrids are often identifiable by their distribution. Distributions of all 3 hybridizing cattail species overlap in only the east-central US coast and central California. Broadleaf cattail and southern cattail cooccur in a broad area of the southwestern United States and the extreme southern United States. Broadleaf cattail and narrow-leaved cattail distribution overlaps are more common and cover a broad area of the central and eastern United States and Canada. Cattail distribution maps are provided by Smith [194].

  • 76. Grace, James B.; Harrison, Janet S. 1986. The biology of Canadian weeds. 73. Typha latifolia L., Typha angustifolia L. and Typha x glauca Godr. Canadian Journal of Plant Science. 66: 361-379. [17673]
  • 194. Smith, S. Galen. 1967. Experimental and natural hybrids in North American typha (Typhaceae). The American Midland Naturalist. 78(2): 257-287. [17667]
  • 107. Kartesz, John T. 1999. A synonymized checklist and atlas with biological attributes for the vascular flora of the United States, Canada, and Greenland. 1st ed. In: Kartesz, John T.; Meacham, Christopher A. Synthesis of the North American flora (Windows Version 1.0), [CD-ROM]. Chapel Hill, NC: North Carolina Botanical Garden (Producer). In cooperation with: The Nature Conservancy; U.S. Department of Agriculture, Natural Resources Conservation Service; U.S. Department of the Interior, Fish and Wildlife Service. [36715]
  • 212. U.S. Department of Agriculture, Natural Resources Conservation Service. 2008. PLANTS Database, [Online]. Available: http://plants.usda.gov/. [34262]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Common Cattail is a common plant that occurs in every county of Illinois. In addition to North America, it is also native to Eurasia. Habitats include marshes, swamps, seeps, borders of rivers and ponds, and ditches. In marshes and other wetlands, this is often one of the dominant plants. Common Cattail can survive in badly degraded habitats, although it also occurs in natural habitats that are less disturbed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Typha latifolia fo. ambigua Kronf.:
Canada (North America)
United States (North America)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Localities documented in Tropicos sources

Typha latifolia L.:
Afghanistan (Asia)
Argentina (South America)
Australia (Oceania)
Brazil (South America)
Canada (North America)
Gabon (Africa & Madagascar)
Guatemala (Mesoamerica)
Honduras (Mesoamerica)
Japan (Asia)
Kyrgyzstan (Asia)
Kazakhstan (Asia)
Mexico (Mesoamerica)
Pakistan (Asia)
Russian Federation (Asia)
Tajikistan (Asia)
Turkmenistan (Asia)
United States (North America)
Uzbekistan (Asia)
China (Asia)

Note: This information is based on publications available through Tropicos and may not represent the entire distribution. Tropicos does not categorize distributions as native or non-native.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Alta., B.C., Man., N.B., Nfld. and Labr. (Nfld.), N.W.T., N.S., Ont., P.E.I., Que., Sask., Yukon; Ala., Alaska, Ariz., Ark., Calif., Colo., Conn., Del., Fla., Ga., Idaho. Ill., Ind., Iowa., Kans., Ky., La., Maine, Md., Mass., Mich., Minn., Miss., Mo., Mont., Nebr., Nev., N.H., N.J., N.Mex., N.Y., N.C., N.Dak., Ohio, Okla., Oreg., Pa., R.I., S.C., S.Dak., Tenn., Tex., Utah, Vt., Va., Wash., W.Va., Wis., Wyo.; Mexico; Central America; South America; Eurasia; Africa; introduced, Australia (Tasmania (introduced)).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The bulrush is widespread in Britain, but is less common in the north and west (2). It seems to have increased in frequency during the 20th Century and is more common in Scotland, Wales and northern England than it was in the 1960s; the reasons for this increase are not yet clear (3). It has a broad global distribution, being found from the Arctic Circle to 30°S, with the exception of central and southern Africa, south Asia, Australia and Polynesia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution: Europe, Central and South East Asia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

For current distribution, please consult the Plant Profile page for this species on the PLANTS Web site. Broad-leaved cattails are common throughout the United States and temperate and tropical places worldwide (Hickman 1993). Typha latifolia occurs in coastal and valley marshes at elevations lower than 2,000 m.

Public Domain

USDA NRCS National Plant Data Center & Idaho Plant Materials Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Description

More info for the terms: marsh, rhizome

This description provides characteristics that may be relevant to fire ecology, and is not meant for identification. Keys for identification are available (e.g., [46,58,71,82,103,172,180,216]).

Aboveground description: Broadleaf cattail is an aquatic or semiaquatic emergent perennial. Morphological and physiological ecotypes as well as hybrids make field identification difficult [82]. Plants are normally 3 to 10 feet (1-3 m) tall, reedlike, and extensively clonal [98,122,172]. Broadleaf cattail stems are stout, cylindrical, and unbranched [5,172]. Flowering stem length is typically equal to or somewhat longer than leaf length [143]. Leaves are thick, linear, flat, and measure 6 to 29 mm wide [5,98]. For plants from Michigan and the southeastern United States, the upper limit of leaf width is less, 15 mm [72,216]. Broadleaf cattail can be highly productive. In a single growing season, a plant grown from seed produced 34 aerial shoots that were 18 to 24 inches (46-61 cm) tall, 29 shoots that were 4 to 18 inches (10-46 cm) tall, 35 shoots measuring 2 to 4 inches (5-10 cm), and 104 lateral buds [238].

Numerous tiny, dense, felty flowers occur in a terminal spike that is 0.7 to 2 inches (1.8-5 cm) thick [46,110,143,172]. Male flowers make up the upper, narrower half of the spike and female flowers the lower, slightly wider half [82,108]. Over 1,000 flowers were counted in the staminate spike portion of one plant [98]. Male and female spikes are rarely separated. A small space of less than 0.6 inch (1.5 cm) may occur [82,108], but separations of up to 1.5 inches (4 cm) are also reported [82]. Some systematists recognize plants with separated male and female spikes as form ambigua [187,216]. Spikes are typically 6 times as long as they are thick [46,110,143,172]. Only female flowers are persistent [143,172]. Fertilized flowers produce single-seeded, nutlike achenes up to 1.5 mm long [122,227]. Long slender hairs at the base allow for wind and water transport of the "eventually dehiscent" seeds [99,172].

Belowground description:
Floras from throughout broadleaf cattail's range describe its rhizomes as tough, stout, coarse, and extensive [36,98,99,172]. Rhizomes grow horizontally just below the soil surface [82]. In a review, lateral rhizomes were reportedly up to 28 inches (70 cm) long, with diameters of 0.2 to 1.2 inches (0.5-3 cm) [76]. Shallow fibrous roots are attached to the rhizomes [10,47].

Some indicate that broadleaf cattail produces 2 types of rhizomes; one that is "more superficial", thin, "feathery", and multibranched, and another that is deeper, thicker, and branching at the base [181]. Rhizome growth and depth are likely affected by substrate texture, moisture, and/or temperature. In the Skokie Marsh of Illinois, the thickest broadleaf cattail rhizomes were 3 to 3.9 inches (7.5-10 cm) deep [190]. From an alluvial basin in central Iowa, long, stout broadleaf cattail rhizomes occurred at 6- to 8-inch (15-20 cm) depths. Rhizomes were soft and spongy, with internal air spaces [96]. For more on vegetative growth, see Vegetative regeneration.

© 2003 George W. Hartwell
Variation/hybrids: Differences in productivity, height, flowering, and other developmental characteristics were evident when broadleaf cattail seeds were collected from various parts of the United States and grown in a common area [147]. High levels of ecotypic variation and the widespread cooccurrence of 2 to 3 compatible cattail species can make field identification difficult. Goodrich and Neese [73] provide specific local information useful in distinguishing broadleaf cattail from similar-looking sympatric species. Broadleaf cattail × southern cattail and broadleaf cattail × narrow-leaved cattail hybrids are described in the following references: [36,56,58,82,91,140]. Often broadleaf cattail hybrids are distinguished by their distribution. For more information, see General Distribution.

Broadleaf cattail × narrow-leaved cattail hybrids, often referred to as T × glauca, have been described as more "robust" and "competitively superior" than either parent in fluctuating water levels, although hybrids are infertile and reproduce only vegetatively [122,216]. Invasiveness of broadleaf cattail × narrow-leaved cattail is discussed briefly in Other Management Considerations [234].

  • 10. Bare, Janet E. 1979. Wildflowers and weeds of Kansas. Lawrence, KS: The Regents Press of Kansas. 509 p. [3801]
  • 103. Hulten, Eric. 1968. Flora of Alaska and neighboring territories. Stanford, CA: Stanford University Press. 1008 p. [13403]
  • 82. Great Plains Flora Association. 1986. Flora of the Great Plains. Lawrence, KS: University Press of Kansas. 1392 p. [1603]
  • 98. Hickman, James C., ed. 1993. The Jepson manual: Higher plants of California. Berkeley, CA: University of California Press. 1400 p. [21992]
  • 5. Anderson, J. P. 1959. Flora of Alaska and adjacent parts of Canada. Ames, IA: Iowa State University Press. 543 p. [9928]
  • 71. Gleason, Henry A.; Cronquist, Arthur. 1991. Manual of vascular plants of northeastern United States and adjacent Canada. 2nd ed. New York: New York Botanical Garden. 910 p. [20329]
  • 36. Cronquist, Arthur; Holmgren, Arthur H.; Holmgren, Noel H.; Reveal, James L.; Holmgren, Patricia K. 1977. Intermountain flora: Vascular plants of the Intermountain West, U.S.A. Vol. 6: The Monocotyledons. New York: Columbia University Press. 584 p. [719]
  • 46. Diggs, George M., Jr.; Lipscomb, Barney L.; O'Kennon, Robert J. 1999. Illustrated flora of north-central Texas. Sida Botanical Miscellany, No. 16. Fort Worth, TX: Botanical Research Institute of Texas. 1626 p. [35698]
  • 47. DiTomaso, Joseph M.; Healy, Evelyn A. 2003. Aquatic and riparian weeds of the West. Publication 3421. Davis, CA: University of California, Agriculture and Natural Resources. 442 p. [48834]
  • 56. Fassett, Norman C.; Calhoun, Barbara. 1952. Introgression between Typha latifolia and T. angustifolia. Evolution. 6(4): 367-379. [68533]
  • 72. Godfrey, Robert K.; Wooten, Jean W. 1979. Aquatic and wetland plants of southeastern United States: Monocotyledons. Athens, GA: The University of Georgia Press. 712 p. [16906]
  • 73. Goodrich, Sherel; Neese, Elizabeth. 1986. Uinta Basin flora. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Region, Ashley National Forest; Vernal, UT: U.S. Department of the Interior, Bureau of Land Management, Vernal District. 320 p. [23307]
  • 76. Grace, James B.; Harrison, Janet S. 1986. The biology of Canadian weeds. 73. Typha latifolia L., Typha angustifolia L. and Typha x glauca Godr. Canadian Journal of Plant Science. 66: 361-379. [17673]
  • 91. Harms, Vernon L.; Ledingham, George F. 1986. The narrow-leaved cat-tail, Typha angustifolia, and the hybrid cat-tail, T. X glauca, newly reported from Saskatchewan. The Canadian Field-Naturalist. 100(1): 107-110. [68453]
  • 96. Hayden, Ada. 1919. The ecologic subterranean anatomy of some plants of a prairie province in central Iowa. American Journal of Botany. 6(3): 87-105. [66943]
  • 99. Hitchcock, C. Leo; Cronquist, Arthur. 1973. Flora of the Pacific Northwest. Seattle, WA: University of Washington Press. 730 p. [1168]
  • 110. Kearney, Thomas H.; Peebles, Robert H.; Howell, John Thomas; McClintock, Elizabeth. 1960. Arizona flora. 2nd ed. Berkeley, CA: University of California Press. 1085 p. [6563]
  • 140. Marcinko Kuehn, Monica; White, Bradley N. 1999. Morphological analysis of genetically identified cattails Typha latifolia, Typha angustifolia, and Typha x glauca. Canadian Journal of Botany. 77(6): 906-912. [68460]
  • 143. Mason, Herbert L. 1957. A flora of the marshes of California. Berkeley, CA: University of California Press. 878 p. [16905]
  • 147. McNaughton, S. J. 1966. Ecotype function in the Typha community-type. Ecological Monographs. 36(4): 297-325. [17676]
  • 172. Pojar, Jim; MacKinnon, Andy, eds. 1994. Plants of the Pacific Northwest coast: Washington, Oregon, British Columbia and Alaska. Redmond, WA: Lone Pine Publishing. 526 p. [25159]
  • 180. Roland, A. E.; Smith, E. C. 1969. The flora of Nova Scotia. Halifax, NS: Nova Scotia Museum. 746 p. [13158]
  • 181. Rowlatt, Ursula; Morshead, Henry. 1993. Architecture of the leaf of the greater reed mace, Typha latifolia L. Botanical Journal of the Linnean Society. 110(2): 161-170. [20144]
  • 187. Seymour, Frank Conkling. 1982. The flora of New England. 2nd ed. Phytologia Memoirs 5. Plainfield, NJ: Harold N. Moldenke and Alma L. Moldenke. 611 p. [7604]
  • 190. Sherff, E. E. 1912. The vegetation of Skokie Marsh, with special reference to subterranean organs and their interrelationships. Botanical Gazette. 53(5): 415-435. [66922]
  • 216. Voss, Edward G. 1972. Michigan flora. Part I: Gymnosperms and monocots. Bloomfield Hills, MI: Cranbrook Institute of Science; Ann Arbor, MI: University of Michigan Herbarium. 488 p. [11471]
  • 227. Welsh, Stanley L.; Atwood, N. Duane; Goodrich, Sherel; Higgins, Larry C., eds. 1987. A Utah flora. The Great Basin Naturalist Memoir No. 9. Provo, UT: Brigham Young University. 894 p. [2944]
  • 234. Woo, Isa; Zedler, Joy B. 2002. Can nutrients alone shift a sedge meadow towards dominance by the invasive Typha x glauca? Wetlands. 22(3): 509-521. [68522]
  • 238. Yeo, R. R. 1964. Life history of common cattail. Weeds. 12: 284-288. [17666]
  • 58. Flora of North America Association. 2008. Flora of North America: The flora, [Online]. Flora of North America Association (Producer). Available: http://www.fna.org/FNA. [36990]
  • 108. Kartesz, John Thomas. 1988. A flora of Nevada. Reno, NV: University of Nevada. 1729 p. [In 2 volumes]. Dissertation. [42426]
  • 122. Larson, Gary E. 1993. Aquatic and wetland vascular plants of the Northern Great Plains. Gen. Tech. Rep. RM-238. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 681 p. Jamestown, ND: Northern Prairie Wildlife Research Center (Producer). Available: http://www.npwrc.usgs.gov/resource/plants/vascplnt/vascplnt.htm [2006, February 11]. [22534]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Plants up to 100-200 cm high. Stem thick, terete. Leaves linear-broadly linear, 8-20 mm broad. Flowering stem equal to or somewhat shorter than the leaves. Male and female parts of inflorescence contiguous. Female parts slightly longer than the male parts at maturity, cylindric, soft, dark brown or blackish brown. Male flowers with simple hairs and pollen in tetrads; filaments 2-3 times as long as anther. Female flower ebracteate, ovary 1/3-1/4 the length of stipe, stigma lanceolate or rhombic, fleshy, dark brown or persistent brown, much surpassing the perianth hairs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Erect shoots 150--300 cm; flowering shoots 1--2 cm thick in middle, stems 3--7 mm thick near inflorescence. Leaves: usually glaucous when fresh; sheath sides papery or membranous, margins narrowly clear, summit tapered into blade to distinctly shouldered, or rarely with firm, papery auricles; mucilage glands at sheath-blade transition usually colorless, obscure, absent from sheath center and blade; widest blades on shoot 10--23(--29) mm wide when fresh, 5--20 mm when dry, distal blades about equaling inflorescence. Inflorescences: staminate spikes contiguous with pistillate or in some clones separated by to 4(--8) cm of naked axis, about as long as pistillate, ca. 1--2 cm thick at anthesis; staminate scales colorless to straw-colored, filiform, simple, ca. 4  0.05 mm; pistillate spikes in flower pale green drying brownish, later blackish brown or reddish brown, in fruit often mottled with whitish patches of pistil-hair tips, 5--25 cm  5--8 mm in flower, 24--36 mm thick in fruit; compound pedicels in fruit bristle-like, variable in same spike, 1.5--3.5 mm; pistillate bracteoles absent. Staminate flowers 5--12 mm; anthers 1--3 mm, thecae yellow, apex dark brown; pollen in tetrads. Pistillate flowers 2--3 mm in flower, 10--15 mm in fruit; pistil-hair tips colorless, whitish in mass, not enlarged; stigmas persistent, forming solid layer on spike surface, pale green in flower, drying brownish, then reddish brown or usually distally blackish, spatulate, ovate to ovate-lanceolate, 0.6--1  0.2--0.25 mm; carpodia exceeded by and hidden among pistil hairs, straw-colored, apex rounded. Seeds numerous. 2n = 30.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Typha latifolia, broad-leaved cattail, is distinguished from T. angustifolia, narrow-leaved cattail, by the relative width of the leaf and the position of the staminate and pistillate portions of the spadix (heads). Typha latifolia has 6-23 mm wide leaves that are flat, sheathing, and pale grayish-green in color. T. angustifolia has 3-8 mm wide leaves that are full green and somewhat convex on back (Agricultural Rea. Service 1971). In T. latifolia the staminate and pistillate heads are contiguous or nearly so, whereas in T. angustifolia the heads are separated by approximately 3 cm.

Cattail fruits differ among the two major species. T. angustifolia fruits are about 5-8 mm long with hairs arising above the middle. T. latifolia fruits are about 1 cm long with hairs arising near the base (Agricultural Rea. Service 1971).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat characteristics

More info for the terms: aerenchyma, density, marsh, minerotrophic, natural, rhizome

Throughout its range, broadleaf cattail is most common in freshwater to slightly brackish marshes, ponds, lakes, ditches, swales, and slow-moving river sites [30,58,172,180].

Climate: Broadleaf cattail's wide distribution implies a wide tolerance of climatic conditions. Broadleaf cattail occurs in tropical, subtropical, southern and northern temperate, humid coastal, and dry continental climates [76]. The following climate descriptions represent some widely different climates experienced in broadleaf cattail habitats in the northern and southernmost portions of its North American range.

Northern habitats: Scattered broadleaf cattail populations occur in central Alaska, where winter temperatures are as low as -31 °F (-34 °C) [76]. Ponds in open subarctic woodlands near Yellowknife, Northwest Territories, occur in subarctic-continental climates and remain frozen from late September to mid- or late May. Winters are long and cold; summers are cool and short with very long periods of sunlight. On 21 June, it is light for 20 hours [60]. Daily temperatures can vary widely in broadleaf cattail marshes of the Ottawa River between Ontario and Quebec. Daily average minimum and maximum temperatures for January are 5 and 23 °F (-15 and -5 °C) and for July are 54.5 and 77 °F (12.5 and 25 °C). An average of 120 days are frost free [42].

Southern or desert habitats: Broadleaf cattail occurs in Diamond Pond in the semiarid desert of Harney County, Oregon. Relative humidity is low, and evaporation is high. A typical growing season is 80 to 117 days. Annual rainfall averages 7.9 to 12 inches (200-300 mm), and snow levels average 33 inches/year. Daily and seasonal temperatures fluctuate widely. In nearby Burns, Oregon, temperature extremes of -33 °F (-36 °C) and 100 °F (39 °C) have been reported [229]. Broadleaf cattail is also found on the edges of Mitry Lake near Yuma, Arizona. This site received 3.5 inches (89 mm) of precipitation in 1963 and 1.5 inches (38 mm) in 1964. Minimum and maximum temperatures in 1964 were 31 °F (-0.5 °C) in January and 104 °F (40 °C) in July [145]. Broadleaf cattail and narrow-leaved cattail-California bulrush communities in southeastern Texas experience frequent droughts and occasional hurricanes. Typically, there are only 6 or so days of freezing temperatures. In Port Arthur, rainfall averages 51.8 inches (1,320 mm). Over a 20-year period, precipitation averages ranged from 31 to 66 inches (840-1,700 mm) [124]. In treeless wet prairies of southern Florida's Everglades region, broadleaf cattail occupies sites with high summer rainfall, high humidity, mild winters, and often a midwinter dry season [135].

Elevation: Broadleaf cattail occupies sites from sea level to 7,500 feet (2,300 m) throughout North America [58]. Elevations at more narrow geographical ranges are given below.

Elevation range of broadleaf cattail by state or region
State/region Elevation (feet)
Arizona 3,500-7,000 [110]
California below 6,500 [98]; broadleaf cattail is the only California cattail found above 3,000 [143]
Colorado 4,000-7,500 [92]
eastern Idaho 2,980-5,740 [86]
central and eastern Montana 1,950-6,350 [90]
Nevada 3,900-6,600 [108]; 3,900-5,000 in central-southern Nevada [14]
New Mexico 4,000-8,000 [142]
Utah 4,200-6,910 [227]; up to 7,000 in the Uinta Basin [73]
Adirondack Uplands 100-1,700 [116]
Pacific Northwest low to midelevations [172]

Soils: Broadleaf cattail tolerates many soil textures, nutrient levels, moisture regimes, and pH levels. Descriptions of soil types as well and flooding, drought, and salinity tolerances are described below.

Texture, pH, and fertility: Sand, silt, loam, and clay substrates are described in broadleaf cattail habitats. Acid to basic soils with low or high levels of nutrients are tolerated. In the Cariboo Forest Region of British Columbia, broadleaf cattail marshes occupy silty clay loam soils with seasonal or permanent water up to 39 inches (100 cm) deep [196]. The top 4 inches (10 cm) of wetland soils on the Pumice Plain of Mount St Helens, Washington, were predominantly silt (67.2-80.7%). Organic matter was low (<0.54%), and pH was 5.7 to 7.2 [210]. Broadleaf cattail in oxbow lakes along the Athabasca River in Alberta occupied basic sites with a pH of up to 9.2 and water depths up to 9.4 inches (24 cm) [132]. Germination of broadleaf cattail seed from central Alberta was not affected at pH levels 4, 7, or 12 [178]. In the Lake Agassiz Peatlands Natural Area of Minnesota, broadleaf cattail was indicative of weakly minerotrophic waters with calcium levels of 3 to10 ppm [97]. In Wisconsin, broadleaf cattail occurred in water with less than 50 ppm and in waters with more than 150 ppm of calcium carbonate [37]. Broadleaf cattail marshes of the Ottawa River between Ontario and Quebec occupy the most fertile temporarily flooded sites available [42]. Detailed descriptions of soil fertility in broadleaf cattail stands in Mississippi, Alabama, Georgia, and Florida are provided by Boyd and Hess [20]. In these areas, broadleaf cattail standing crop biomass was positively correlated with the concentration of phosphorus in the soil and water (r =0.69).

Floating mats: Sometimes broadleaf cattail occurs on floating mats with minimal soil development. In a freshwater marsh northeast of Sackville, New Brunswick, floating mats of broadleaf cattail × narrow-leaved cattail were 16 to 24 inches (40-60 cm) thick in water 31 to 39 inches (80-100 cm) deep. Developing small mats got their buoyancy from aerenchyma (tissue with air spaces) in the rhizomes, while older, thicker mats floated on trapped air bubbles produced during anaerobic decomposition [101]. In oxbow lakes along the Athabasca River in Alberta, broadleaf cattail occurred on floating mats in nutrient-poor lakes and was rooted on more nutrient-rich sites [132].

Soil salinity: Broadleaf cattail tolerates brackish waters; however, salinity tolerance may differ with developmental stage. Choudhuri [27] found that broadleaf cattail germination decreased with increasing salinity, and no seeds germinated above 1 atm of osmotic pressure. However, broadleaf cattail was "quite tolerant" of salinity as a seedling and as an established plant. In marshes of southeastern Louisiana, broadleaf cattail occurred at salt levels up to 1.13% [171]. In oxbow lakes along the Athabasca River of Alberta, broadleaf cattail occurred where salinity, measured as water conductivity, was 260 to 1,380 μs/cm [132]. A review of the vegetative characteristics of prairie marshes in western Canada reports that broadleaf cattail tolerates salinity levels of less than 10 mS/cm [189].

Flooding: Broadleaf cattail is tolerant of fluctuating water levels [189] and some flooding; however, death or colonization failure has occurred at flood levels as low as 25 inches (63 cm) [197], and stands grow in 3 feet (1 m) of water in wetlands of southeastern Alberta [111]. Flood tolerance has been associated with rhizome production, season, age, associated vegetation, and disturbances.

Broadleaf cattail grew in a maximum water depth of 27 inches (68 cm) in monoculture ponds created at the W. K. Kellogg Biological Station of Michigan and in a maximum depth of 24 inches (61 cm) in ponds with narrow-leaved cattail [81]. In the same ponds, broadleaf cattail grew at 31-inch (80 cm) depths in May but was restricted to less than 31-inch (80 cm) depths in September [77]. In experimental ponds at the University of Arkansas, broadleaf cattail died when water depths exceeded 37 inches (95 cm), and broadleaf cattail density was greatest at 8.7-inch (22 cm) depths. Broadleaf cattail height increased with increased water depths, but plants flowered only when roots were not submerged [75]. In a storage pool at the Montezuma National Wildlife Refuge in New York, broadleaf cattails less than 1 year old died when water levels were at or above 18 inches (46 cm). Two-year-old seedlings did not spread when water levels were 18 to 20 inches (46-51 cm), and at depths over 25 inches (63 cm), even well-established plants died [197].

In controlled field and greenhouse studies, broadleaf cattail and broadleaf cattail × narrow-leaved cattail rhizome production decreased in water levels of 12 inches (30 cm) or more [225]. In the 1st year of pond flooding in areas drawn down for 2 to 5 years in northwestern Minnesota's Agassiz National Wildlife Refuge, broadleaf cattail and broadleaf cattail × narrow-leaved cattail grew well at all water depths. After 3 years of flooding, broadleaf cattail death was substantial in 18 inches (46 cm) of water. Broadleaf cattail × narrow-leaved cattail growth and survival were good in up to 24 inches (61 cm) of water. By the 5th flooded year, broadleaf cattail was dead in all continuously flooded areas, but survival was good in temporarily flooded areas [93]. In the Crescent Pond south of Lake Manitoba, the density of broadleaf cattail × narrow-leaved cattail was greatest at 9.8-inch (25 cm) and 39-inch (100 cm) depths. Density was lowest at 33 inches (85 cm). Shoot height generally increased with increasing water depths, suggesting a plastic growth response [220].

Flooded conditions after cutting or burning often result in death. Abovewater plant material is necessary to tolerate flooding. When broadleaf cattail and broadleaf cattail × narrow-leaved cattail stems were cut below the water surface and kept flooded, both species died [225]. Broadleaf cattail rhizomes in a highly anaerobic environment in southern Michigan maintained high concentrations of oxygen as long as some portion of the plant remained above water. Plants cut below water 3 times in a growing season experienced almost complete belowground death. Researchers suggested that aerenchyma throughout the stems and rhizomes transported oxygen from the atmosphere to the rhizomes [183].

Drought tolerance: Broadleaf cattail is described as "fairly drought tolerant" [89]. In the Montezuma National Wildlife Refuge on the northern end of Cayuga Lake in New York, broadleaf cattail stands grew in 0.9 inch (2.2 cm) of standing water in June but were dry in July and August [57]. In marshes of Utah that were drained and kept dry for 2 years, there was 100% broadleaf cattail mortality [164]. The potential for broadleaf cattail regrowth with flooding was not discussed.

  • 89. Hansen, Paul L.; Chadde, Steve W.; Pfister, Robert D. 1988. Riparian dominance types of Montana. Misc. Publ. No. 49. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station. 411 p. [5660]
  • 98. Hickman, James C., ed. 1993. The Jepson manual: Higher plants of California. Berkeley, CA: University of California Press. 1400 p. [21992]
  • 20. Boyd, Claude E.; Hess, Lloyd W. 1970. Factors influencing shoot production and mineral nutrient levels in Typha latifolia. Ecology. 51(2): 296. [68529]
  • 27. Choudhuri, G. N. 1968. Effect of soil salinity on germination and survival of some steppe plants in Washington. Ecology. 49(3): 465-471. [623]
  • 30. Clewell, Andre F. 1985. Guide to the vascular plants of the Florida Panhandle. Tallahassee, FL: Florida State University Press. 605 p. [13124]
  • 37. Curtis, John T. 1959. Aquatic communities. In: Curtis, John T. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press: 385-401. [60531]
  • 42. Day, R. T.; Keddy, P. A.; McNeill, J.; Carleton, T. 1988. Fertility and disturbance gradients: a summary model for riverine marsh vegetation. Ecology. 69(4): 1044-1054. [39768]
  • 57. Fickbohm, Scott S.; Zhu, Wei-Zing. 2006. Exotic purple loosestrife invasion of native cattail freshwater wetlands: effects on organic matter distribution and soil nitrogen cycling. Applied Soil Ecology. 32(1): 123-131. [68446]
  • 60. Fournier, Michael A.; Hines, James E. 1998. Breeding ecology and status of the red-necked grebe, Podiceps grisegena, in the subarctic of the Northwest Territories. The Canadian Field-Naturalist. 112(3): 474-480. [68448]
  • 73. Goodrich, Sherel; Neese, Elizabeth. 1986. Uinta Basin flora. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Region, Ashley National Forest; Vernal, UT: U.S. Department of the Interior, Bureau of Land Management, Vernal District. 320 p. [23307]
  • 75. Grace, James B. 1989. Effects of water depth on Typha latifolia and Typha domingensis. American Journal of Botany. 76(5): 762-768. [1822]
  • 76. Grace, James B.; Harrison, Janet S. 1986. The biology of Canadian weeds. 73. Typha latifolia L., Typha angustifolia L. and Typha x glauca Godr. Canadian Journal of Plant Science. 66: 361-379. [17673]
  • 77. Grace, James B.; Wetzel, Robert G. 1981. Habitat partitioning and competitive displacement in cattails (Typha): experimental field studies. The American Naturalist. 118(4): 463-474. [17674]
  • 81. Grace, James B.; Wetzel, Robert G. 1998. Long-term dynamics of Typha populations. Aquatic Botany. 61(2): 137-146. [68452]
  • 86. Hall, James B.; Hansen, Paul L. 1997. A preliminary riparian habitat type classification system for the Bureau of Land Management districts in southern and eastern Idaho. Tech. Bull. No. 97-11. Boise, ID: U.S. Department of the Interior, Bureau of Land Management; Missoula, MT: University of Montana, School of Forestry, Riparian and Wetland Research Program. 381 p. [28173]
  • 90. Hansen, Paul; Boggs, Keith; Pfister, Robert; Joy, John. 1990. Classification and management of riparian and wetland sites in central and eastern Montana. Draft Version 2. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station, Montana Riparian Association. 279 p. [12477]
  • 92. Harrington, H. D. 1964. Manual of the plants of Colorado. 2nd ed. Chicago, IL: The Swallow Press, Inc. 666 p. [6851]
  • 93. Harris, Stanley W.; Marshall, William H. 1963. Ecology of water-level manipulations on a northern marsh. Ecology. 44(2): 331-343. [17808]
  • 97. Heinselman, M. L. 1970. Landscape evolution, peatland types and the environment in the Lake Agassiz Peatlands Natural Area, Minnesota. Ecological Monographs. 40(2): 235-261. [8378]
  • 101. Hogg, Edward H.; Wein, Ross W. 1988. The contribution of Typha components to floating mat buoyancy. Ecology. 69(4): 1025-1031. [18405]
  • 110. Kearney, Thomas H.; Peebles, Robert H.; Howell, John Thomas; McClintock, Elizabeth. 1960. Arizona flora. 2nd ed. Berkeley, CA: University of California Press. 1085 p. [6563]
  • 111. Keith, Lloyd B. 1961. A study of waterfowl ecology on small impoundments in southeastern Alberta. Wildlife Monographs. 6: 1-88. [4501]
  • 116. Kudish, Michael. 1992. Adirondack upland flora: an ecological perspective. Saranac, NY: The Chauncy Press. 320 p. [19376]
  • 124. Lay, Daniel W.; O'Neil, Ted. 1942. Muskrats on the Texas coast. Journal of Wildlife Management. 6(4): 301-311. [14561]
  • 132. Lieffers, V. J. 1983. Growth of Typha latifolia in boreal forest habitats, as measured by double sampling. Aquatic Botany. 15: 335-348. [17670]
  • 135. Long, Robert W. 1974. The vegetation of southern Florida. Florida Scientist. 37(1): 33-45. [9151]
  • 142. Martin, William C.; Hutchins, Charles R. 1981. A flora of New Mexico. Volume 2. Germany: J. Cramer. 2589 p. [37176]
  • 143. Mason, Herbert L. 1957. A flora of the marshes of California. Berkeley, CA: University of California Press. 878 p. [16905]
  • 145. McDonald, Charles C.; Hughes, Gilbert H. 1968. Studies of consumptive use of water by phreatophytes and hydrophytes near Yuma, Arizona. In: Water resources of lower Colorado River--Salton Sea area. Geological Survey Professional Paper 486-F. Washington, DC: U.S. Department of the Interior, Geological Survey: F1 to F24. [18347]
  • 164. Nelson, Noland F.; Dietz, Reuben H. 1966. Cattail control methods in Utah. Publication No. 66-2. Salt Lake City, UT: Utah State Department of Fish and Game. 66 p. [17809]
  • 171. Penfound, W. T.; Hathaway, Edward S. 1938. Plant communities in the marshlands of southeastern Louisiana. Ecological Monographs. 8(1): 3-56. [15089]
  • 172. Pojar, Jim; MacKinnon, Andy, eds. 1994. Plants of the Pacific Northwest coast: Washington, Oregon, British Columbia and Alaska. Redmond, WA: Lone Pine Publishing. 526 p. [25159]
  • 178. Rivard, Paul G.; Woodard, Paul M. 1989. Light, ash, and pH effects on the germination and seedling growth of Typha latifolia (cattail). Canadian Journal of Botany. 67: 2783-2787. [14769]
  • 180. Roland, A. E.; Smith, E. C. 1969. The flora of Nova Scotia. Halifax, NS: Nova Scotia Museum. 746 p. [13158]
  • 183. Sale, P. J. M.; Wetzel, Robert G. 1983. Growth and metabolism of Typha species in relation to cutting treatments. Aquatic Botany. 15: 321-334. [50593]
  • 189. Shay, Jennifer M.; Shay, C. Thomas. 1986. Prairie marshes in western Canada, with specific reference to the ecology of five emergent macrophytes. Canadian Journal of Botany. 64: 443-454. [18397]
  • 196. Steen, O. A.; Roberts, A. L. 1988. Guide to wetland ecosystems of the Very Dry Montane Interior Douglas-fir Subzone, Eastern Fraser Plateau Variant (IDFb2) in the Cariboo Forest Region, British Columbia. Williams Lake, BC: British Columbia Ministry of Forests and Lands. 101 p. [53384]
  • 197. Steenis, John H.; Smith, Lawrence P.; Cofer, Henry P. 1959. Studies on cattail management in the Northeast. In: Transactions of the Northeast wildlife conference: Proceedings; 1958 June 4-7; Montreal, QC. Montreal, QC: University of Montreal, Department of Game and Fisheries: 149-155. [19975]
  • 210. Tu, Mandy; Titus, Jonathan H.; Tsuyuzaki, Shiro; del Moral, Roger. 1998. Composition and dynamics of wetland seed banks on Mount St. Helens, Washington, USA. Folia Geobotanica. 32(1): 3-16. [68516]
  • 220. Waters, I.; Shay, J. M. 1992. Effect of water depth on population parameters of a Typha glauca stand. Canadian Journal of Botany. 70(2): 349-351. [68556]
  • 225. Weller, Milton W. 1975. Studies of cattail in relation to management for marsh wildlife. Iowa State Journal of Research. 49(4): 383-412. [18158]
  • 227. Welsh, Stanley L.; Atwood, N. Duane; Goodrich, Sherel; Higgins, Larry C., eds. 1987. A Utah flora. The Great Basin Naturalist Memoir No. 9. Provo, UT: Brigham Young University. 894 p. [2944]
  • 229. Wigand, Peter Ernest. 1987. Diamond Pond, Harney County, Oregon: vegetation history and water table in the eastern Oregon desert. The Great Basin Naturalist. 47(3): 427-458. [5980]
  • 14. Beatley, Janice C. 1976. Vascular plants of the Nevada Test Site and central-southern Nevada: ecologic and geographic distributions. [Washington, DC]: U.S. Energy Research and Development Administration, Division of Biomedical and Environmental Research. 308 p. Available from ERDA, Springfield, VA. TID-26881/DAS. [63152]
  • 58. Flora of North America Association. 2008. Flora of North America: The flora, [Online]. Flora of North America Association (Producer). Available: http://www.fna.org/FNA. [36990]
  • 108. Kartesz, John Thomas. 1988. A flora of Nevada. Reno, NV: University of Nevada. 1729 p. [In 2 volumes]. Dissertation. [42426]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Key Plant Community Associations

More info for the terms: alliance, bog, cover, fen, marsh, natural, succession, swamp

Broadleaf cattail is typical of early-seral, open-canopy communities.
It occurs immediately or soon after disturbance in moist or wet habitats and occurs
early in the primary succession of open water or debris flows. In forested
habitats, broadleaf cattail persists only temporarily in disturbed sites.
Broadleaf cattail occurred with up to 39% cover after a severe fire in pondcypress (Taxodium
distichum var. imbricarium) domes near Gainesville, Florida. Five years
after the fire, broadleaf cattail cover ranged from 0% to 5% [54].

Often wetlands are dominated by one or just a few clonal species occurring
in zones or concentric rings that are largely determined by flooding and
water level tolerances [41,146,209].
Numerous wetland plant communities and habitat types are described, and
broadleaf cattail is often recognized as a dominant species.
United States:

Alaska:



  • broadleaf cattail floating wet mat communities in the northwestern part of Tanana
    Flats south of Fairbanks [174]

California:


  •  


  • bulrush (Scirpus spp.)-cattail tule marshes common in the Central Valley [24]




  • brackish hardstem bulrush (Schoenoplectus acutus var. acutus)-broadleaf cattail
    marshes common in San Francisco Bay [137]




  • tule marshes along the Sacramento and San Joaquin
    rivers; marshes part of wet grasslands Forest and Range Ecosystem No. 41 [67]




  • tule marsh potential natural vegetation type [115]




  • tule marsh and cattail-sedge (Carex spp.) communities; variants of the
    wetland Rangeland Cover Type (Cheatham and Haller, cited in [2])

Colorado:



  • softstem bulrush (S. tabernaemontani)-broadleaf cattail and broadleaf cattail wetlands
    throughout the state (references in [8])

Florida:



  • floating island type vegetation dominated by beggarticks (Bidens spp.),
    broadleaf cattail, and smartweed (Polygonum spp.) in Orange Lake in Alachua County [139]




  • broadleaf cattail marshes and cattail associations near brackish water in southern Florida [41]

Idaho:



  • broadleaf cattail habitat types along ponds and reservoirs at
    elevations of 2,980 to 5,740 feet (909-1,750 m) in the east [86]




  • broadleaf cattail plant associations throughout the state [104]




  • broadleaf cattail-softstem bulrush marshes in the Chilly Slough Wetland Conservation Area
    in Custer County [237]

Illinois:



  • broadleaf cattail-tussock sedge (Carex stricta) communities along creek
    borders in Cook County's Bluff Spring Fen Nature Preserve [200]




  • broadleaf cattail dominated marshes in the Gavin Bog and Prairie Nature Preserve in Lake County [204]

Kansas:



  • softstem bulrush-cattail-bur-reed-rush (Sparganium-Juncus spp.)
    in swales and river system depressions; southern and narrow-leaved cattail
    possible, broadleaf cattail probable




  • cattail-Olney threesquare (Scirpus americanus) in oxbows and low areas along creeks and streams;
    all cattail species possible




  • cattail-scouringrush horsetail-sedge (Equisetum hyemale) on
    hillsides and bluffs in river valleys; broadleaf and/or narrow-leaved cattail may dominate [123]

Louisiana:



  • broadleaf cattail-California bulrush (S. californicus) associations in southeastern freshwater marshes [171]

Montana:



  • broadleaf cattail herblands in riparian areas [12]




  • broadleaf cattail habitat types in northwestern Montana [18] and central and eastern Montana [90]

Nebraska:



  • annual wildrice (Zizania aquatica)-broadleaf
    cattail and broadleaf cattail-hardstem bulrush communities in Cherry County [209]

New Mexico:



  • broadleaf cattail-Olney threesquare and broadleaf cattail-rice cutgrass (Leersia oryzoides)
    community types in the upper and/or middle Rio Grande watersheds [52]




  • broadleaf cattail-common threesquare (Schoenoplectus pungens
    var. pungens) communities widespread in Pecos and Rio Grande basins, likely throughout New Mexico




  • softstem bulrush-broadleaf cattail vegetation throughout New Mexico [160]

Nevada:



  • broadleaf cattail western herbaceous vegetation type within the
    cattail-bulrush (Schoenoplectus spp.) semipermanently flooded herbaceous alliance [165]




  • tule marshes around large lakes; marshes part of wet
    grasslands forest and range ecosystem No. 41 [67]

North Carolina:



  • broadleaf cattail-rush-Jamaica swamp sawgrass (Cladium mariscus subsp.
    jamaicense) and rush-broadleaf cattail-Virginia saltmarsh mallow (Kosteletzkya virginica)
    freshwater marsh communities on Shackleford Bank [7]




  • interdune pond communities (vegetation varies with water depth)




  • broadleaf cattail-black rush (Juncus roemerianus) tidal
    freshwater marsh communities [184]




  • cattail-bulrush hydric freshwater marsh associations on the
    Coastal Plain; broadleaf and narrow-leaved cattail common [226]

Oklahoma:



  • broadleaf cattail herbaceous vegetation associations on floodplains, backswamps, and lake margins




  • broadleaf cattail-powdery alligator-flag (Thalia dealbata)
    associations in marshes, ponds and on lake margins in eastern and central Oklahoma [100]

Pennsylvania:



  • broadleaf cattail palustrine emergent wetland vegetation types in
    Gettysburg National Military Park [236]

Utah:



  • hardstem bulrush-broadleaf cattail marshes around Utah Lake in Provo Bay and
    Powell's Slough [21]




  • tule marshes on old beds of the Great Salt Lake;
    marshes part of wet grasslands Forest and Range Ecosystem No. 41 [67]

Washington:



  • hardstem bulrush-broadleaf cattail communities in ponds with 1- to 3-foot
    (0.3-0.9 m) deep water in steppe vegetation in the Columbia Basin [39,61]




  • broadleaf cattail plant associations in eastern National Forests [113]




  • broadleaf cattail-toad rush (Juncus bufonius) community types in narrow seeps on
    the Pumice Plains of Mount St Helens [43]

West Virginia:



  • broadleaf cattail-bog goldenrod/sphagnum (Solidago uliginosa/Sphagnum recurvum-S.
    imbricatum) communities in Laurel Run Bog




  • broadleaf cattail/bristly dewberry/recurved sphagnum (Rubus hispidus/S. recurvum)
    communities in Cupp Run Swamp [217]

Wyoming:



  • broadleaf cattail cover types on wet or moist sites throughout the state [32]

Western and central United States and Canada:



  • broadleaf cattail community types at low elevations of Utah and southeastern Idaho [176]




  • semiaquatic wetlands of the rooted emergent class dominated by broadleaf cattail
    and hardstem bulrush in Idaho and western Montana [173]




  • broadleaf cattail types in semipermanently and saturated palustrine wetlands in the prairie potholes of north-central
    United States and south-central Canada [106]




  • broadleaf cattail/broadleaf arrowhead (Sagittaria latifolia) plant associations
    in Wyoming, Nebraska, and Colorado [105]




  • broadleaf cattail marshes in Montana, Wyoming, Colorado, Nebraska, and New Mexico




  • bulrush-cattail marshes in the northern Great Plains
    (Manitoba, Minnesota, Montana, and North and South Dakota)




  • Olney threesquare-cattail communities in the central and southern Great Plains
    (Colorado, Kansas, Nebraska, New Mexico, Oklahoma,
    and Texas); broadleaf, narrow-leaved, and southern cattail possible




  • cattail-American lotus (Nelumbo lutea) in
    Oklahoma and Texas; broadleaf and southern cattail common [186]

Canada:

Alberta:



  • softstem bulrush-broadleaf cattail reed swamp
    associations of large sloughs and lakes in central Alberta [130]

British Columbia:



  • broadleaf cattail marsh associations in the Cariboo Forest Region [196]

Ontario:



  • broadleaf cattail vegetation types in marshes along
    the Ottawa River between Ontario and Quebec [42]

  • 18. Boggs, Keith; Hansen, Paul; Pfister, Robert; Joy, John. 1990. Classification and management of riparian and wetland sites in northwestern Montana. Draft Version 1. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station, Montana Riparian Association. 217 p. [8447]
  • 2. Allen-Diaz, Barbara H. 1994. SRM 217: Wetlands. In: Shiflet, Thomas N., ed. Rangeland cover types of the United States. Denver, CO: Society for Range Management: 25-26. [66687]
  • 7. Au, Shu-fun. 1974. Vegetation and ecological processes on Shackleford Bank, North Carolina. Scientific Monograph Series No. 6--NPS 113. Washington, DC: U.S. Department of the Interior, National Park Service. 86 p. [16101]
  • 8. Baker, William L. 1984. A preliminary classification of the natural vegetation of Colorado. The Great Basin Naturalist. 44(4): 647-676. [380]
  • 12. Batchelor, Ron; Erwin, Mike; Martinka, Robert; McIntosh, Don; Pfister, Robert; Schneegas, Edward; Taylor, Jack; Walther, Kit. 1982. A taxonomic classification system for Montana riparian vegetation types: An interagency approach to classifying Montana's riparian ecosystems. Bozeman, MT: Montana State Rural Areas Development Committee, Wildlife Subcommittee, Riparian Program Team. 13 p. [31151]
  • 21. Brotherson, Jack D. 1981. Aquatic and semiaquatic vegetation of Utah Lake and its bays. The Great Basin Naturalist Memoirs. 5: 68-84. [11212]
  • 24. California Academy of Sciences. 1964. Tule marshes (Scirpus-Typha). In: Kuchler, A. W. Manual to accompany the map of potential vegetation of the conterminous United States. Special Publication No. 36. New York: American Geographical Society: 49. [67376]
  • 32. Collins, Ellen I. 1984. Preliminary classification of Wyoming plant communities. Cheyenne, WY: Wyoming Natural Heritage Program/The Nature Conservancy. 42 p. [661]
  • 39. Daubenmire, R. 1970. Steppe vegetation of Washington. Technical Bulletin 62. Pullman, WA: Washington State University, College of Agriculture, Washington Agricultural Experiment Station. 131 p. [733]
  • 41. Davis, John H., Jr. 1943. The natural features of southern Florida: especially the vegetation, and the Everglades. Geological Bulletin No. 25. Tallahassee, FL: State of Florida, Department of Conservation, Florida Geological Survey. 311 p. [17747]
  • 42. Day, R. T.; Keddy, P. A.; McNeill, J.; Carleton, T. 1988. Fertility and disturbance gradients: a summary model for riverine marsh vegetation. Ecology. 69(4): 1044-1054. [39768]
  • 43. del Moral, Roger. 1999. Predictability of primary successional wetlands on pumice, Mount St. Helens. Madrono. 46(4): 177-186. [36256]
  • 52. Durkin, Paula; Muldavin, Esteban; Bradley, Mike; Carr, Stacey E. 1996. A preliminary riparian/wetland vegetation community classification of the upper and middle Rio Grande watersheds in New Mexico. In: Shaw, Douglas W.; Finch, Deborah M., technical coordinators. Desired future conditions for southwestern riparian ecosystems: bringing interests and concerns together: Proceedings; 1995 September 18-22; Albuquerque, NM. Gen. Tech. Rep. RM-GTR-272. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 44-57. [26192]
  • 54. Ewel, Katherine Carter. 1984. Effects of fire and wastewater on understory vegetation in cypress domes. In: Ewel, Katherine Carter; Odum, Howard T., eds. Cypress swamps. Gainesville, FL: University of Florida Press: 119-126. [14845]
  • 61. Franklin, Jerry F.; Dyrness, C. T. 1973. Natural vegetation of Oregon and Washington. Gen. Tech. Rep. PNW-8. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 417 p. [961]
  • 67. Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; Lewis, Mont E.; Smith, Dixie R. 1977. No. 41--the wet grasslands ecosystem. In: Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; Lewis, Mont E.; Smith, Dixie R. Vegetation and environmental features of forest and range ecosystems. Agric. Handb. 475. Washington, DC: U.S. Department of Agriculture, Forest Service: 56-58. [68423]
  • 86. Hall, James B.; Hansen, Paul L. 1997. A preliminary riparian habitat type classification system for the Bureau of Land Management districts in southern and eastern Idaho. Tech. Bull. No. 97-11. Boise, ID: U.S. Department of the Interior, Bureau of Land Management; Missoula, MT: University of Montana, School of Forestry, Riparian and Wetland Research Program. 381 p. [28173]
  • 90. Hansen, Paul; Boggs, Keith; Pfister, Robert; Joy, John. 1990. Classification and management of riparian and wetland sites in central and eastern Montana. Draft Version 2. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station, Montana Riparian Association. 279 p. [12477]
  • 100. Hoagland, Bruce. 2000. The vegetation of Oklahoma: a classification for landscape mapping and conservation planning. The Southwestern Naturalist. 45(4): 385-420. [41226]
  • 104. Jankovsky-Jones, Mabel; Rust, Steven K.; Moseley, Robert K. 1999. Riparian reference areas in Idaho: a catalog of plant associations and conservation sites. Gen. Tech. Rep. RMRS-GTR-20. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 141 p. [29900]
  • 105. Johnston, Barry C. 1987. Plant associations of Region Two: Potential plant communities of Wyoming, South Dakota, Nebraska, Colorado, and Kansas. 4th ed. R2-ECOL-87-2. Lakewood, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Region. 429 p. [54304]
  • 106. Kantrud, Harold A.; Millar, John B.; van der Valk, A. G. 1989. Vegetation of wetlands of the prairie pothole region. In: van der Valk, Arnold, ed. Northern prairie wetlands. Ames, IA: Iowa State University Press: 132-187. [15217]
  • 113. Kovalchik, Bernard L.; Clausnitzer, Rodrick R. 2004. Classification and management of aquatic, riparian, and wetland sites on the national forests of eastern Washington: series description. Gen. Tech. Rep. PNW-GTR-593. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 354 p. [53329]
  • 115. Kuchler, A. W. 1964. Manual to accompany the map of potential vegetation of the conterminous United States. Special Publication No. 36. New York: American Geographical Society. 77 p. [1384]
  • 123. Lauver, Chris L.; Kindscher, Kelly; Faber-Langendoen, Don; Schneider, Rick. 1999. A classification of the natural vegetation of Kansas. The Southwestern Naturalist. 44(4): 421-443. [38847]
  • 130. Lewis, Francis J.; Dowding, Eleanor S.; Moss, E. H. 1928. The vegetation of Alberta: II. The swamp, moor and bog forest vegetation of central Alberta. Journal of Ecology. 16: 19-70. [12798]
  • 137. MacDonald, Keith B. 1977. Coastal salt marsh. In: Barbour, M. G.; Major, J., eds. Terrestrial Vegetation of California. New York: John Wiley and Sons: 263-294. [27548]
  • 139. Mallison, Craig T.; Stocker, Randall K.; Cichra, Charles E. 2001. Physical and vegetative characteristics of floating islands. Journal of Aquatic Plant Management. 39: 107-111. [68546]
  • 146. McLaughlin, W. T. 1932. Atlantic coastal plain plants in the sand barrens of northwestern Wisconsin. Ecological Monographs. 2(3): 335-383. [17126]
  • 160. Muldavin, Esteban; Durkin, Paula; Bradley, Mike; Stuever, Mary; Mehlhop, Patricia. 2000. Handbook of wetland vegetation communities of New Mexico. Volume I: classification and community descriptions. Albuquerque, NM: University of New Mexico, Biology Department; New Mexico Natural Heritage Program. 172 p. (+ appendices). [45517]
  • 171. Penfound, W. T.; Hathaway, Edward S. 1938. Plant communities in the marshlands of southeastern Louisiana. Ecological Monographs. 8(1): 3-56. [15089]
  • 173. Rabe, Fred W.; Chadde, Steve W. 1994. Classification of aquatic and semiaquatic wetland natural areas in Idaho and western Montana. Natural Areas Journal. 14(3): 175-187. [23962]
  • 174. Racine, Charles H.; Walters, James C. 1994. Groundwater-discharge fens in the Tanana Lowlands, interior Alaska, U.S.A. Arctic and Alpine Research. 26(4): 418-426. [53512]
  • 196. Steen, O. A.; Roberts, A. L. 1988. Guide to wetland ecosystems of the Very Dry Montane Interior Douglas-fir Subzone, Eastern Fraser Plateau Variant (IDFb2) in the Cariboo Forest Region, British Columbia. Williams Lake, BC: British Columbia Ministry of Forests and Lands. 101 p. [53384]
  • 200. Stoynoff, Nick A. 1993. A quantitative analysis of the vegetation of Bluff Spring Fen Nature Preserve. Transactions, Illinois State Academy of Science. 63(3/4): 93-110. [23734]
  • 204. Taft, John B.; Solecki, Mary Kay. 1990. Vascular flora of the wetland and prairie communities of Gavin Bog and Prairie Nature Preserve, Lake County, Illinois. Rhodora. 92(871): 142-165. [14522]
  • 209. Tolstead, W. L. 1942. Vegetation of the northern part of Cherry County, Nebraska. Ecological Monographs. 12: 255-292. [4470]
  • 217. Walbridge, Mark R.; Lang, Gerald E. 1982. Major plant communities and patterns of community distribution in four wetlands of the unglaciated Appalachian region. In: McDonald, Brian R., ed. Proceedings, symposium on wetlands of the unglaciated Appalachian region; 1982 May 26-28; Morgantown, WV. Morgantown, WV: West Virginia University: 131-142. [42222]
  • 226. Wells, B. W. 1928. Plant communities of the coastal plain of North Carolina and their successional relations. Ecology. 9(2): 230-242. [9307]
  • 236. Yahner, R. H.; Storm, G. L.; Melton, R. E.; Vecellio, G. M.; Cottam, D. F. 1991. Floral inventory and vegetative cover type mapping of Gettysburg National Military Park and Eisenhower National Historic Site. Tech. Rep. NPS/MAR/NRTR-91/050. Philadelphia, PA: U.S. Department of the Interior, National Park Service, Mid-Atlantic Region. 149 p. [17987]
  • 165. Nevada Natural Heritage Program. 2003. National vegetation classification for Nevada [NVC], [Online]. Carson City, NV: Nevada Department of Conservation and Natural Resources (Producer). Available: http://heritage.nv.gov/ecology/nv_nvc.htm [2005, November 3]. [55021]
  • 176. Rainier Seeds, Inc. 2003. Catalog, [Online]. Davenport, WA: Rainer Seeds, Inc., (Producer). Available: http://www.rainerseeds.com [2003, February 14]. [27624]
  • 184. Schafale, Michael P.; Weakley, Alan S. 1990. Classification of the natural communities of North Carolina: 3rd approximation. Raleigh, NC: Department of Environment, Health, and Natural Resources, Division of Parks and Recreation, North Carolina Natural Heritage Program. 325 p. Available online: http://ils.unc.edu/parkproject/nhp/publications/class.pdf [2005, February 14]. [41937]
  • 186. Schneider, Rick E.; Faber-Langendoen, Don; Crawford, Rex C.; Weakley, Alan S. 1997. The status of biodiversity in the Great Plains: Great Plains vegetation classification. Supplemental Document 1. In: Ostlie, Wayne R.; Schneider, Rick E.; Aldrich, Janette Marie; Faust, Thomas M.; McKim, Robert L. B.; Chaplin, Stephen J., compilers. The status of biodiversity in the Great Plains, [Online]. Arlington, VA: The Nature Conservancy (Producer). 75 p. Available: http://conserveonline.org/docs/2005/02/greatplains_vegclass_97.pdf [2006, May 16]. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. [62020]
  • 237. Yeo, Jeffrey J. 2002. Vegetation communities of the Chilly Slough Wetland Conservation Area. Technical Bulletin No. 02-5. Boise, ID: U.S. Department of the Interior, Bureau of Land Management, Idaho State Office. 31 p. Available: http://www.id.blm.gov/techbuls/02_05/doc.pdf [2003, September 18]. [45251]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range and Habitat in Illinois

Common Cattail is a common plant that occurs in every county of Illinois. In addition to North America, it is also native to Eurasia. Habitats include marshes, swamps, seeps, borders of rivers and ponds, and ditches. In marshes and other wetlands, this is often one of the dominant plants. Common Cattail can survive in badly degraded habitats, although it also occurs in natural habitats that are less disturbed.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fresh to slightly brackish water or wet soil; 0--2300m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Cattails have a cosmopolitan distribution and a wide ecological amplitude. Typha can be found in wetlands, sedge meadows, along slow moving streams, river banks, and lake shores. The plant is found in areas of widely fluctuating water levels such as roadside ditches, reservoirs and other disturbed wet soil areas. Cattails commonly invade the pelagic zones of bogs (Gustafson 1976). Typical associates include Phragmites australiis, Lythrum salicaria, Spartina sp., Acorus calamus, Scirpus sp., and Sagittaria latifolia.

Typha latifolia is the only species of cattail usually found in relatively undisturbed habitats (Smith 1967). It is found throughout North America from sea level to 2134 M (7000 feet) elevation. The tolerance of T. latifolia to high concentrations of lead, zinc, copper, and nickel has been demonstrated (Taylor and Crowder 1984). This species has been employed in secondary waste water treatment schemes (Gopal and Sharma 1980).

Narrow-leaved cattail can grow in deeper water compared to T. latifolia, although both species reach maximum growth at a water depth of 50 cm (20 inches) (Grace and Wetzel 1981). A robust hybrid between narrow-leaved and broad-leaved cattail, Typha x glauca, has similar habitat requirements to T. angustifolia.

Typha latifolia is found in the most favorable sites where it competes against other species. T. angustifolia and T. domingensis are restricted to less favorable and more saline habitats when they occur with T. latifolia (Gustafson 1976). Typha latifolia often displaces T. angustifolia in shallow (<15 cm) water, restricting the latter species to deep water (Grace and Wetzel 1981). Theodore Cochran (pers. comm), of the University of Wisconsin-Madison herbarium states that most early herbarium specimens are T. latifolia and only recently have T. angustifolia specimens been collected from Wisconsin wetlands.

Cattails can grow on a wide gradient of substrate types. Wet pure sand, peat, clay and loamy soils have been documented under cattail stands. World wide distribution of cattails is summarized by Morton (1975).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Grows on mud or in shallow water at the margins of lakes, ditches, ponds and canals, and less commonly beside streams and rivers. It shows a preference for sites that are rich in nutrients (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dispersal

Establishment

      Adaptation: Typha latifolia generally occurs in shallower water than Typha angustifolia. Compared to T. angustifolia, T. latifolia is exploitative in its ability to clone rapidly and produce a large leaf surface area, which may contribute to its superior competitive ability (Grace and Wetzel 1982). Typha latifolia has been found to be tolerant of water level fluctuations and moderate soil salinity. Cattail spreads both vegetatively and by seed, particularly under drawdown (Shay et al. 1986).

      Cattails are always found in or near water, in marshes, ponds, lakes and depressions. They are obligate wetland indicator plant species. Cattails tolerate perennial flooding, reduced soil conditions and moderate salinity. With influxes of nutrient or freshwater, cattails are aggressive invaders in both brackish salt marshes and freshwater wetlands.

      Cattails, like many emergent wetland species, tolerate flood drawdown cycles that occur to varying degrees in different wetland and riparian systems. Flood and drought are disturbance factors that vary in frequency, magnitude, and predictability. Frequency relates to the number of episodes per unit time while magnitude of flooding can be expressed in terms of water volume, velocity, gradient, depth, duration, and season of inundation. When planting cattails, the flood-draw-down cycles must be taken into consideration for successful revegetation.

      Planting: Typha species may be planted from bare rootstock or seedlings from container stalk or directly seeded into the soil. Bare rootstock or seedlings are preferred revegetation methods where there is moving water. Typha seeds germinate readily and are a cost-effective means to propagate cattail on moist soils. To ensure a long-term stable ecosystem, it is recommended that Typha be just one of the species in the mix for wetland restoration.

      Seed Collections: Select seed collection sites where continuous stands with few intermixed species can easily be found. At each collection location, obtain permission for seed collection.

    • Seed is harvested by either taking hand clippers and cutting the stem off below the seed heads or stripping the seed heads off the stalk.

    • Collect and store seeds in brown paper bags or burlap bags. Seeds are then dried in these bags.

    • Seeds can be harvested when they are slightly immature. It is important to harvest the staminate stalks before they dry and blow away.

    • Seeds and seed heads need to be cleaned in a seed cleaner. Plant cleaned seed in fall.

    • Plant in clean, weed - free, moist seed bed. Flooded or ponded soils will significantly increase seedling mortality.

    • Broadcast seed and roll in or rake 1/4" to 1/2" from the soil surface.

    • Some seed may be lost due to scour or flooding. Recommended seed density is unknown at this time.

    Seed germination in greenhouse: Clean seed - blow out light seed.

  • To grow seeds, plant in greenhouse in 1" x 1" x 2" pots, 1/4" under the soil surface. Keep soil surface moist. Greenhouse temperature should be 100 degrees F (plus or minus 5 degrees). Seeds begin to germinate after a couple weeks in warm temperatures.

  • Plants are ready in 100 - 120 days to come out as plugs. By planting seeds in August, plugs are ready to plant in soil by November. These plants are very small; growing plants to a larger size will result in increased revegetation success.

Live Plant Collections: No more than 1/4 of the plants in an area should be collected. If no more than 0.09 m2 (1 ft2) should be removed from a 0.4 m2 (4 ft2) area, the plants will grow back in the hole in one good growing season. A depth of 15 cm (6 in) is sufficiently deep for digging plugs. This will leave enough plants and rhizomes to grow back during the growing season. Donor plants, which are drought-stressed, tend to have higher revegetation success.

Live transplants should be planted in moist (not flooded or anoxic) soils as soon as possible. Plants should be transported and stored in a cool location prior to planting. Plugs may be split into smaller units, generally no smaller than 6 x 6 cm (2.4 x 2.4 in), with healthy rhizomes and tops. The important factor in live plant collections is to be sure to include a growing bud in either plugs or rhizomes. Weeds in the plugs should be removed by hand. For ease in transport, soil may be washed gently from roots. The roots should always remain moist or in water until planted.

Clip leaves and stems from 15 to 25 cm (6 to 10 in); this allows the plant to allocate more energy into root production. Plant approximately 1 meter apart. Plants should be planted closer together if the site has fine soils such as clay or silt, steep slopes, or prolonged inundation.

Ideally, plants should be planted in moist soils in late fall just after the first rains (usually late October to November). This enables plant root systems to become established before heavy flooding and winter dormancy occurs. Survival is highest when plants are dormant and soils are moist. Fertilization is very helpful for plant growth and reproduction. Many more seeds are produced with moderate fertilization.

Public Domain

USDA NRCS National Plant Data Center & Idaho Plant Materials Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Faunal Associations

The caterpillars of various moths feed on cattails (either the leaves, stalk, flowers, or developing seeds). These moths include Bellura obliqua (Cattail Borer Moth) and other Bellura spp., Dicymolomia julianalis (Pyralid Moth sp.), Limnaecia phragmitella (Shy Cosmet), and Simyra henrici (Henry's Marsh Moth). The starchy rootstocks of Cattails are an important source of food to Muskrats. The Canada Goose and other geese eat the rootstocks to a more limited extent. Dense stands of cattails provide cover for many wetland animals and birds; many wetland birds nest in cattail marshes and the leaves of cattails are often used as nesting material. These wetland birds include the Marsh Wren, Yellow-Headed Blackbird, Red-Winged Blackbird, Common Moorhen, American Coot, various Rails, and Bitterns.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Great Britain and/or Ireland:
Foodplant / saprobe
sporodochium of Arthrinium dematiaceous anamorph of Arthrinium sporophleum is saprobic on dead leaf of Typha latifolia
Remarks: season: 3-4

Foodplant / sap sucker
adult of Chilacis typhae sucks sap of seed head of Typha latifolia

Foodplant / spot causer
Colletotrichum coelomycetous anamorph of Colletotrichum typhae causes spots on live leaf of Typha latifolia

Foodplant / feeds on
larva of Donacia aquatica feeds on root of Typha latifolia

Plant / resting place / among
cocoon of Donacia cinerea may be found among roots of Typha latifolia

Foodplant / open feeder
adult of Donacia vulgaris grazes on leaf of Typha latifolia

Foodplant / saprobe
fruitbody of Epithele typhae is saprobic on dead leaf base of Typha latifolia
Other: minor host/prey

Foodplant / saprobe
immersed conidioma of Hymenopsis coelomycetous anamorph of Hymenopsis typhae is saprobic on dead stem of Typha latifolia
Remarks: season: 5-6

Foodplant / saprobe
apothecium of Lachnum controversum is saprobic on dead stem of Typha latifolia
Remarks: season: 5-10
Other: minor host/prey

Foodplant / saprobe
fruitbody of Lindtneria trachyspora is saprobic on dead, decayed leaf of Typha latifolia

Foodplant / feeds on
Notaris bimaculatus feeds on stem of Typha latifolia

Foodplant / saprobe
immersed pseudothecium of Ophiobolus typhae is saprobic on submerged, dead, attached leaf base of Typha latifolia

Plant / resting place / within
puparium of Phaonia atriceps may be found in leaf-sheath of Typha latifolia

Foodplant / feeds on
pycnidium of Phoma coelomycetous anamorph of Phoma typharum feeds on Typha latifolia

Foodplant / spot causer
pycnidium of Phyllosticta coelomycetous anamorph of Phyllosticta typhina causes spots on leaf (tip) of Typha latifolia
Remarks: season: 7

Plant / resting place / among
cocoon of Plateumaris sericea may be found among root of Typha latifolia

Foodplant / saprobe
fruitbody of Psathyrella typhae is saprobic on dead stem (just above waterline) of Typha latifolia
Other: major host/prey

Foodplant / saprobe
covered, black pycnidium of Septoria coelomycetous anamorph of Septoria menispora is saprobic on dead leaf of Typha latifolia
Remarks: season: 3-4

Foodplant / saprobe
often numerous, immersed, black pycnidium of Stagonospora coelomycetous anamorph of Stagonospora typhoidearum is saprobic on sometimes locally discoloured leaf of Typha latifolia

Foodplant / feeds on
larva of Stilbus oblongus feeds on Typha latifolia

Plant / resting place / on
fruitbody of Tomentella ellisii may be found on dead, decayed debris of Typha latifolia
Other: unusual host/prey

Foodplant / saprobe
fruitbody of Typhula capitata is saprobic on dead, decayed leaf of Typha latifolia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known Pests: Arzama OPBLIQUA, NONAGRIA OBLONGA, APHIDS AND COLANDRA PERTINAUX

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Fire Management Considerations

More info for the term: fuel

Fire and postfire flooding have been used to reduce broadleaf cattail abundance. Several challenges commonly occur when burning wetland habitats. Fuel loads are often high, and fires may burn "hotter" and "faster" than upland vegetation. Construction of fire breaks and maneuverability may also pose challenges in wetlands habitats [179]. Smoke produced in burning wetlands has been compared to the thick, black smoke produced when burning tires (Meyer, personal communication in [179]).

In the Carlos Avery Wildlife Management Area, managers used fire to maintain open water in dense cattail stands. Water levels were drawn down, and cattail vegetation was burned in the summer. Sites were flooded for several weeks, and cattail was typically removed for at least 2 years (Rhode, personal communication in [179]). Beule [16] reported that spring fires, ignited on a sunny day in drained marshes following a winter with very little moisture, are most likely to produce cattail mortality. Winds directing smoke away from populated areas are important when burning cattail wetlands [16].

Prescribed fires and postfire flooding were used to decrease cattail abundance in marshes of the St Clair National Wildlife Area of southwestern Ontario. Marshes were dominated by the broadleaf cattail × narrow-leaved cattail hybrid, although both parent species were present as well. The researcher indicated that winter fires were likely less "intense" than summer fires in drained marshes and likely easier to control. Submergence of postfire stubble was necessary to produce cattail mortality. Backfires left the shortest stubble (7 inches (18 cm)), and water levels were not raised much to kill the plants. Stubble may be taller if snow builds up on the ice before burning, and deeper flooding may be required to kill cattails. Later season burning may reduce this problem. The researcher noted that burning in successive years was not feasible because regrowth did not provide enough fuel to carry fire [9]. See the Research Project Summary of Ball's [9] study for a more detailed description of this study and its findings.
  • 9. Ball, John P. 1984. Habitat selection and optimal foraging by mallards: a field experiment. Guelph, ON: University of Guelph. 44 p. Thesis. [18071]
  • 16. Beule, John D. 1979. Control and management of cattails in southeastern Wisconsin wetlands. Tech. Bull No. 112. Madison, WI: Department of Natural Resources. 40 p. [14574]
  • 179. Robertson, Morgan M. 1997. Prescribed burning as a management and restoration tool in wetlands of the upper Midwest. In: Restoration and reclamation review: Student on-line journal (Hort 5015/5071): Vol. 2-spring 1997: restoration techniques. Available: http://www.hort.agri.umn.edu/h5015/97papers/robertson.html [2007, December 18]. [68900]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Broad-scale Impacts of Plant Response to Fire

More info for the terms: cover, density, fire severity, fuel, fuel moisture, importance value, litter, marsh, prescribed fire, severity, succession, swamp

Studies on the postfire regeneration and recovery of broadleaf cattail are limited.
After severe fires in established stands, broadleaf cattail abundance rarely decreases.
However, postfire hydrology, depth of burn, and prefire moisture conditions can
affect regeneration. Flooded conditions after fire
can cause broadleaf cattail mortality [179,182]. A summer fire
on a drained marsh significantly reduced broadleaf cattail × narrow-leaved cattail cover, density, and height
(P<0.05) from that of an unburned control. Burned and unburned sites
were compared 3 years after fire [138].


Severe and/or dry-season fires:
Numerous fire studies in broadleaf cattail habitats described the fires as
severe, but rarely was broadleaf cattail abundance lower on burned than unburned
sites in early postfire years. Broadleaf cattail occurred in severely burned
marsh meadows in the Oregon Coast Range. Sites burned at least 11 years earlier.
Broadleaf cattail was absent from adjacent mature western hemlock (Tsuga
heterophylla)-Douglas-fir forests (about 300 years old) [163]. Burned
and unburned wetlands in Mono Lake Tufa State Reserve, California, were
only visibly different in litter abundance 1 year after a fall prescribed fire.
Strip fires burned in the fall when wind speeds were low. Fires produced
near-black smoke and flame lengths of up to 10 feet (3 m) and were described as
"high intensity". In the following April, broadleaf cattail was nearly 1.6 feet
(0.5 m) tall on burned sites, and burned sites were green before unburned sites
[11]. After the September Red Bench Fire that burned wet sedge meadows in Glacier
National Park, broadleaf cattail had 0.5% cover in the 2nd postfire year but was
not reported in the 1st or 3rd postfire years. The fire burned when conditions
were extremely dry and often burned to mineral soil. Prefire data were not
given, but unburned meadows were dominated by beaked sedge (Carex rostrata)
with near exclusion of other species [231]. After severe fires in smooth
cordgrass (Spartina alterniflora) and sawgrass (Cladium jamaicensis)
swamps of southeastern Texas, cattail increased in the understory. After another
severe winter fire 2 years later, when conditions were dry, cattail increased
even more [124].

© 2005 Ross Orr.
Fall prescribed fire in a cattail
marsh in Washtenaw County, Michigan

Invasion after fire:
Broadleaf cattail appeared after severe fire or fires during dry conditions in baldcypress and pondcypress
habitats. Two sites in pondcypress domes near Gainesville, Florida, were severely burned in December.
Broadleaf cattail occurred only on burned sites and was not present before the fires.
Broadleaf cattail was very rare in undisturbed pondcypress domes. In the 1st postfire
year, broadleaf cattail cover was 10% to 12%. Cover was
greatest, 30% to 38%, in the 2nd postfire year. By the 5th postfire year, cover of
broadleaf cattail was reduced to less than 5% in the domes [54]. In pondcypress swamps of southern
Florida's Corkscrew Swamp Sanctuary, burned, logged, and logged and burned sites were compared.
Logging occurred about 25 years earlier, and burning occurred in June, 7 to 8
years earlier in an excessively dry year. Broadleaf cattail was absent from logged sites,
but average importance values ranged from 2 to 8.5 on logged and burned sites. On
only burned sites, broadleaf cattail's importance value averaged 2.2. On burned and burned
and logged sites, pondcypress was absent and coastal plain willow (Salix caroliniana) dominated the canopy
[84]. Broadleaf cattail did not occur in
baldcypress-dominated woodlands of the Pocomoke River Swamp on
Maryland's eastern shore, but after a fire, broadleaf cattail
clumps and monocultures appeared on shallow sites. Researchers considered
broadleaf cattail a pioneer "fire weed" in postfire hydrarch succession
[15]. Fire severity, fire season, and time since fire were not reported.
Broadleaf cattail × narrow-leaved cattail:
On the Hog Lake impoundment of the Tintamarre Marsh northeast of Sackville, New
Brunswick, summer prescribed burning in drained areas significantly reduced
broadleaf cattail × narrow-leaved cattail cover, density, and height, but summer burning in flooded areas increased cover
significantly from unburned reference areas (P<0.05). Spring, summer, and fall fires occurred in
flooded and drained areas of the marsh. Broadleaf cattail × narrow-leaved cattail cover,
density, and height were compared 3 years after fire. In most spring and fall
burn treatments, burned and unburned sites were rarely different, except
broadleaf cattail height was significantly greater on spring-burned
flooded marsh than on unburned flooded marsh (P<0.05) [138].
Average cover, density, and height
of broadleaf cattail × narrow-leaved cattail on drained and flooded, unburned and burned sites 3 years after fires [138]
Drained marsh
 UnburnedSpring burnedSummer burnedFall burned
Cover (%)56a54a36b48a
Density (stems/m²)15a14a9b12ab
Height (cm)133ab126b111c130a
Flooded marsh
Cover (%)41a44ab55b46ab
Density (stems/m²)10a10a12a10a
Height (cm)155a165b158ab156a
Values with different
letters within the same row are significantly different (P<0.05).

Postfire flooding/grazing:
While most studies indicate that broadleaf cattail is highly tolerant of fire,
increasing depths of postfire flooding often produce increased broadleaf cattail
mortality. Preferential
grazing on burned sites may also decrease broadleaf cattail abundance. In the Howard Slough
of Utah, a prescribed fire burned most broadleaf cattail stems to the ground. Fire season and severity were not
reported. The slough was flooded with 1 to 18 inches (2.5-46 cm) of water
immediately after the fire. Broadleaf cattail growth was "heavy" on
intermittently flooded and shallow-water
sites (<8 inches (20 cm) "soon" after the fire, but it was
absent from deep-water sites (8-18 inches (20-46 cm)) [164].
In Lacreek National Wildlife Refuge in southwestern South Dakota, cattail cover
(narrow-leaved and broadleaf) was about double on unburned than on burned sites flooded with
4 to 12 inches (10-30 cm) of water after fire (P<0.05). Prescribed
fires burned 2 sites in the fall and 2 sites in the spring. Cattail cover was similar
on 1-year-old burned sites, regardless of burn season (P>0.05). Sites were
without standing water by summer. Fires burned when fuel moisture was 41% to 253%, soil moisture was 36.5%
to 123%, temperatures were 66 to 79 °F (19-26 °C), and relative
humidity levels were 30% to 37%. Fires removed almost all aboveground
fuels but did not consume any organic soil.
Postfire herbivory was not different between protected and unprotected sites,
indicating that grazers did not preferentially feed on burned sites [182].
Average annual production of broadleaf cattail was much lower on burned and
grazed than undisturbed sites 1 year after treatments in the Ogden Bay Waterfowl Management Area freshwater marsh
in Utah. Waterfowl and common muskrats preferentially grazed burned sites.
Drawdown began in April, and prescribed fires burned in
early September. Windspeed averaged 10.3 miles (16.6 km)/h, dew point averaged
41 °F (5 °C), and the maximum daily temperature was 83 °F (28.5 °C) during the
fire. Sites were flooded 1 week after burning. Broadleaf cattail regenerated
entirely through sprouting; there were no seedlings on burned sites. Burned and
burned and grazed sites had lower broadleaf cattail production than unburned and
ungrazed sites [193].
Production of broadleaf cattail
on control, burned, and grazed freshwater marsh in Utah
[193]
 Burned and grazedBurnedGrazedControl (UB/UG)
Average annual broadleaf cattail production (g/m²/yr)521±486¹1,173±1,1611,614±4372,532±948
¹Standard deviation.
  • 15. Beaven, George Francis; Oosting, Henry J. 1939. Pocomoke Swamp: a study of a cypress swamp on the eastern shore of Maryland. Bulletin of the Torrey Botanical Club. 66: 376-389. [14507]
  • 54. Ewel, Katherine Carter. 1984. Effects of fire and wastewater on understory vegetation in cypress domes. In: Ewel, Katherine Carter; Odum, Howard T., eds. Cypress swamps. Gainesville, FL: University of Florida Press: 119-126. [14845]
  • 84. Gunderson, Lance H. 1984. Regeneration of cypress in logged and burned strands at Corkscrew Swamp Sanctuary, Florida. In: Ewel, Katherine Carter; Odum, Howard T., eds. Cypress swamps. Gainesville, FL: University of Florida Press: 349-357. [14857]
  • 124. Lay, Daniel W.; O'Neil, Ted. 1942. Muskrats on the Texas coast. Journal of Wildlife Management. 6(4): 301-311. [14561]
  • 138. Mallik, A. U.; Wein, Ross W. 1986. Response of a Typha marsh community to draining, flooding, and seasonal burning. Canadian Journal of Botany. 64: 2136-2143. [17672]
  • 163. Neiland, Bonita J. 1958. Forest and adjacent burn in the Tillamook Burn area of northwestern Oregon. Ecology. 39(4): 660-671. [8879]
  • 164. Nelson, Noland F.; Dietz, Reuben H. 1966. Cattail control methods in Utah. Publication No. 66-2. Salt Lake City, UT: Utah State Department of Fish and Game. 66 p. [17809]
  • 182. Saenz, Jose H., Jr.; Smith, Loren M. 1995. Effects of spring and fall burning on cattail in South Dakota. In: Cerulean, Susan I.; Engstrom, R. Todd, eds. Fire in wetlands: a management perspective: Proceedings, 19th Tall Timbers fire ecology conference; 1995 November 3-6; Tallahassee, FL. No. 19. Tallahassee, FL: Tall Timbers Research Station: 151-157. [25783]
  • 193. Smith, Loren M.; Kadlec, John A. 1985. Fire and herbivory in a Great Salt Lake marsh. Ecology. 66(1): 259-265. [7619]
  • 231. Willard, E. Earl; Wakimoto, Ronald H.; Ryan, Kevin C. 1995. Vegetation recovery in sedge meadow communities within the Red Bench Fire, Glacier National Park. In: Cerulean, Susan I.; Engstrom, R. Todd, eds. Fire in wetlands: a management perspective: Proceedings, 19th Tall Timbers fire ecology conference; 1993 November 3-6; Tallahassee, FL. No. 19. Tallahassee, FL: Tall Timbers Research Station: 102-110. [25778]
  • 11. Barry, W. James; Carle, David H.; Carle, Janet A. 2002. The use of prescribed fire in wetland restoration at Mono Lake Tufa State Reserve. In: Sugihara, Neil G.; Morales, Maria; Morales, Tony, eds. Fire in California ecosystems: integrating ecology, prevention and management: Proceedings of the symposium; 1997 November 17-20; San Diego, CA. Misc. Pub. No. 1. [Place of publication unknown]: Association for Fire Ecology: 263-272. [46209]
  • 179. Robertson, Morgan M. 1997. Prescribed burning as a management and restoration tool in wetlands of the upper Midwest. In: Restoration and reclamation review: Student on-line journal (Hort 5015/5071): Vol. 2-spring 1997: restoration techniques. Available: http://www.hort.agri.umn.edu/h5015/97papers/robertson.html [2007, December 18]. [68900]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plant Response to Fire

More info for the terms: frequency, litter, peat, rhizome

When established broadleaf cattail stands burn, plants sprout from the rhizome almost immediately after fire [11,193]. Even severely burned sites may differ from unburned sites in litter amounts as early as 1 year after fire [11].

Seedling establishment occurs on burned sites [63], but the seed source is unclear. In several fire studies, broadleaf cattail plants were not present before the fire but appeared soon after the fire on burned sites. Whether or not burned site colonization was primarily from dispersed seed, a persistent seed bank, or both sources is uncertain. Numerous studies without prefire or unburned comparisons make regeneration inferences difficult. Also see Seed banking and Seed dispersal.

Postfire seedling establishment: Controlled studies suggest that recently burned sites provide good broadleaf cattail germination habitat. Broadleaf cattail seed collected in central Alberta germinated best in light (P<0.01), and germination increased when seeds kept in the dark were watered with a mixture of broadleaf cattail ash and distilled water. Total seedling length also increased with ash treatments in the light and dark. Researchers indicated that high light and ash levels on burned sites may promote broadleaf cattail germination [178]. After a summer fire on peatlands of Dane County, Wisconsin, the frequency of mature broadleaf cattail plants and seedlings was 16% to 96% on 1-year-old burned sites. The fire burned to an average depth of 1 foot (0.3 m) into the peat layer. Frequency of seedlings was greatest near a ditch with an established broadleaf cattail population [63].

  • 63. Frolik, A. L. 1941. Vegetation on the peat lands of Dane County, Wisconsin. Ecological Monographs. 11(1): 117-140. [16805]
  • 178. Rivard, Paul G.; Woodard, Paul M. 1989. Light, ash, and pH effects on the germination and seedling growth of Typha latifolia (cattail). Canadian Journal of Botany. 67: 2783-2787. [14769]
  • 193. Smith, Loren M.; Kadlec, John A. 1985. Fire and herbivory in a Great Salt Lake marsh. Ecology. 66(1): 259-265. [7619]
  • 11. Barry, W. James; Carle, David H.; Carle, Janet A. 2002. The use of prescribed fire in wetland restoration at Mono Lake Tufa State Reserve. In: Sugihara, Neil G.; Morales, Maria; Morales, Tony, eds. Fire in California ecosystems: integrating ecology, prevention and management: Proceedings of the symposium; 1997 November 17-20; San Diego, CA. Misc. Pub. No. 1. [Place of publication unknown]: Association for Fire Ecology: 263-272. [46209]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Broad-scale Impacts of Fire

More info for the terms: marsh, peat

Mortality may occur when severe fires burn in drained marshes [138]. Fires that burn deep into the peat layer of a dry marsh may also cause cattail mortality [16].
  • 16. Beule, John D. 1979. Control and management of cattails in southeastern Wisconsin wetlands. Tech. Bull No. 112. Madison, WI: Department of Natural Resources. 40 p. [14574]
  • 138. Mallik, A. U.; Wein, Ross W. 1986. Response of a Typha marsh community to draining, flooding, and seasonal burning. Canadian Journal of Botany. 64: 2136-2143. [17672]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Immediate Effect of Fire

Fire typically only top-kills broadleaf cattail [164].
  • 164. Nelson, Noland F.; Dietz, Reuben H. 1966. Cattail control methods in Utah. Publication No. 66-2. Salt Lake City, UT: Utah State Department of Fish and Game. 66 p. [17809]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Post-fire Regeneration

More info for the terms: ground residual colonizer, initial off-site colonizer, rhizome, secondary colonizer

POSTFIRE REGENERATION STRATEGY [199]:
Rhizomatous herb, rhizome in soil
Ground residual colonizer (on site, initial community)
Initial off-site colonizer (off site, initial community)
Secondary colonizer (on-site or off-site seed sources)
  • 199. Stickney, Peter F. 1989. Seral origin of species comprising secondary plant succession in Northern Rocky Mountain forests. FEIS workshop: Postfire regeneration. Unpublished draft on file at: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. 10 p. [20090]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fire Ecology

More info for the terms: fire frequency, fire management, fire regime, fire-free interval, frequency, fuel, ground fire, hardwood, litter, low-severity fire, marsh, natural, prescribed fire

Fire adaptations: After fires in established broadleaf cattail stands, broadleaf cattail typically sprouts from rhizomes. Within 1 year of the fire, burned and unburned sites may only be different in litter accumulations [11]. Broadleaf cattail may also occur on burned forested and woodland sites within 1 year of a fire, even though plants were not present before the fire [54]. These findings suggest that broadleaf cattail germinates from a persistent seed bank or is rapidly dispersed to burned sites.

FIRE REGIMES: Broadleaf cattail is restricted to moist or wet sites; however, some indicate that these habitats can burn frequently [40,65]. Fires are not considered frequent in all broadleaf cattail habitats, though. In alluvial communities of the southeastern Coastal Plain, broadleaf cattail occurs at the edge of oxbow lakes, where fire is not common [29]. It is likely that FIRE REGIMES in broadleaf cattail marshes and stands are dictated by surrounding upland vegetation. If nearby vegetation is highly flammable and conditions are dry, fire is likely in broadleaf cattail vegetation [65].

Fuels: Fires are not uncommon in broadleaf cattail habitats, and often fuel loads are more than adequate for fire spread. Robertson [179] reported that the fuel load/unit area in wetlands can be higher than that of uplands in the upper Midwest. Wetland fires may burn "hotter" and, given proper conditions, "faster" than upland sites. Fires in cattail marshes produce thick, black smoke, similar to that produced when tires burn (Rhode, personal communication in [179]).
© 2005 Louis M Landry, photo taken in Lac Boivin, Granby, Quebec

Pre- and early-settlement fires: Several studies report that Native people as well as early trappers and settlers burned wetland vegetation to improve travel, hunting success, and food availability. In northern Alberta, Native people concentrated burning in wetlands (Lewis, personal communication in [206]). The Kumeyaay of southern California reportedly burned cattail marshes at 3-year intervals (Shipeck as cited in [11]). In south-central Manitoba, delta marshes were intentionally burned by early trappers to improve travel, expose common muskrat lodges and coyote, fox, and American mink dens, and concentrate wildlife into unburned areas. Early settlers often burned Manitoba meadows to improve forage quality. Meadow fires often escaped and burned adjacent marshes. Burning often occurred in the first warm days of spring [219]. For more on the use of broadleaf cattail by Native people and early settlers, see Other Uses.

Fires in presettlement time were frequent in several broadleaf cattail habitats across its range. In the Central Valley of California, freshwater marsh vegetation grows linearly and was likely important to north-south fire spread during dry conditions. Freshwater marsh vegetation is very productive and provides abundant fuel [232]. In the Driftless Area peatlands of Tempealeau County, Wisconsin, where broadleaf cattail is a common emergent, pollen records indicate that fire frequency was high before European settlement [40]. Frost [65] suggests that marshes in North Carolina's Croatan National Forest burned "frequently" in fires originating in flammable adjacent upland vegetation. Likely the fire frequency would have been similar to that of surrounding mixed-pine (Pinus spp.) and pond pine (P. serotina) communities, which typically burned every 1 to 3 years in presettlement times.

Spontaneous combustion: A report of spontaneous combustion was reported in marshlands along the shore of Lake Pontchartrain near Mandeville, Louisiana. Witnesses watched a fire "apparently ignited spontaneously" on 4 August 1924 in a time of "unprecedented drought". Water levels were several feet below the soil surface, and temperatures in neighboring towns were 100 to 104 °F (38-40 °C). Additional investigations in the area revealed that at least 100 separate fires were burning along an 18-mile stretch of marsh and pine vegetation. Other possible ignition sources were ruled out because of accessibility and timing. Weather reports indicated that heating and ignition conditions necessary for spontaneous agricultural fires occurred that day near Lake Pontchartrain. Other naturalists in the area suggested that ignition may have come from a creeping ground fire [215].

Changes in fire frequency: Fire exclusion has likely decreased fire frequency in broadleaf cattail habitats. On the North Fork of the Flathead River drainage, Montana, wet sedge meadows, where broadleaf cattail occurs on newly-disturbed sites, did not burn from 1926 to 1988. Researchers indicated that this was the longest fire-free interval since 1600 [231].

Prescribed fire practices may also reduce fire frequency in broadleaf cattail vegetation from what likely occurred in presettlement times. Fire lines used to control wildfires and prescribed fires are often constructed in the upland-wetland transition areas, where broadleaf cattail is common. Prior to active fire management, fires may have burned through the wetlands [64].

Communities listed below are those where broadleaf cattail has the greatest potential as a persistent species. Since FIRE REGIMES typical of broadleaf cattail stands are likely related to FIRE REGIMES in adjacent upland communities, also see the complete FEIS Fire Regime Table.

Fire regime information on vegetation communities in which broadleaf cattail may occur. For each community, fire regime characteristics are taken from the LANDFIRE Rapid Assessment Vegetation Models [121]. These vegetation models were developed by local experts using available literature, local data, and/or expert opinion as documented in the PDF file linked from the name of each Potential Natural Vegetation Group listed below. Cells are blank where information is not available in the Rapid Assessment Vegetation Model.
Pacific Northwest California Southwest Great Basin Northern Rockies
Northern Great Plains Great Lakes Northeast South-central US Southern Appalachians
Southeast        
Pacific Northwest
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northwest Grassland
Marsh Replacement 74% 7    
Mixed 26% 20    
California
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
California Grassland
Herbaceous wetland Replacement 70% 15    
Mixed 30% 35    
Wet mountain meadow-Lodgepole pine (subalpine) Replacement 21% 100    
Mixed 10% 200    
Surface or low 69% 30    
Southwest
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Southwest Forested
Riparian forest with conifers Replacement 100% 435 300 550
Riparian deciduous woodland Replacement 50% 110 15 200
Mixed 20% 275 25  
Surface or low 30% 180 10  
Great Basin
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Great Basin Grassland
Mountain meadow (mesic to dry) Replacement 66% 31 15 45
Mixed 34% 59 30 90
Great Basin Forested
Stable aspen-cottonwood, no conifers Replacement 31% 96 50 300
Surface or low 69% 44 20 60
Stable aspen without conifers Replacement 81% 150 50 300
Surface or low 19% 650 600 >1,000
Northern Rockies
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northern Rockies Shrubland
Riparian (Wyoming)
Mixed 100% 100 25 500
Northern Great Plains
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northern Plains Woodland
Northern Great Plains wooded draws and ravines Replacement 38% 45 30 100
Mixed 18% 94    
Surface or low 43% 40 10  
Great Plains floodplain Replacement 100% 500    
Great Lakes
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Great Lakes Forested
Great Lakes floodplain forest
Mixed 7% 833    
Surface or low 93% 61    
Northeast
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northeast Grassland
Northern coastal marsh Replacement 97% 7 2 50
Mixed 3% 265 20  
South-central US
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
South-central US Forested
Southern floodplain Replacement 42% 140    
Surface or low 58% 100    
Southern Appalachians
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Southern Appalachians Forested
Bottomland hardwood forest Replacement 25% 435 200 >1,000
Mixed 24% 455 150 500
Surface or low 51% 210 50 250
Mixed mesophytic hardwood Replacement 11% 665    
Mixed 10% 715    
Surface or low 79% 90    
Southeast
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Southeast Grassland
Everglades sawgrass Replacement 96% 3 2 15
Surface or low 4% 70    
Floodplain marsh Replacement 100% 4 3 30
Everglades (marl prairie) Replacement 45% 16 10 20
Mixed 55% 13 10  
Pond cypress savanna Replacement 17% 120    
Mixed 27% 75    
Surface or low 57% 35    
Southern tidal brackish to freshwater marsh Replacement 100% 5    
Gulf Coast wet pine savanna Replacement 2% 165 10 500
Mixed 1% 500    
Surface or low 98% 3 1 10
Southeast Shrubland
Pocosin Replacement 1% >1,000 30 >1,000
Mixed 99% 12 3 20
Southeast Woodland
Atlantic wet pine savanna Replacement 4% 100    
Mixed 2% 175    
Surface or low 94% 4     
Southeast Forested
Maritime forest Replacement 18% 40   500
Mixed 2% 310 100 500
Surface or low 80% 9 3 50
Southern floodplain Replacement 7% 900    
Surface or low 93% 63    
*Fire Severities
Replacement: Any fire that causes greater than 75% top removal of a vegetation-fuel type, resulting in general replacement of existing vegetation; may or may not cause a lethal effect on the plants.
Mixed: Any fire burning more than 5% of an area that does not qualify as a replacement, surface, or low-severity fire; includes mosaic and other fires that are intermediate in effects.
Surface or low: Any fire that causes less than 25% upper layer replacement and/or removal in a vegetation-fuel class but burns 5% or more of the area [88,120].
  • 29. Christensen, Norman L. 1988. Vegetation of the southeastern Coastal Plain. In: Barbour, Michael G.; Billings, William Dwight, eds. North American terrestrial vegetation. Cambridge: Cambridge University Press: 317-363. [17414]
  • 40. Davis, Anthony M. 1979. Wetland succession, fire and the pollen record: a Midwestern example. The American Midland Naturalist. 102(1): 86-94. [7311]
  • 54. Ewel, Katherine Carter. 1984. Effects of fire and wastewater on understory vegetation in cypress domes. In: Ewel, Katherine Carter; Odum, Howard T., eds. Cypress swamps. Gainesville, FL: University of Florida Press: 119-126. [14845]
  • 64. Frost, Cecil C.; Walker, Joan; Peet, Robert K. 1986. Fire-dependent savannas and prairies of the Southeast: original extent, preservation status and management problems. In: Kulhavy, D. L.; Conner, R. N., eds. Wilderness and natural areas in the eastern United States: a management challenge. Nacogdoches, TX: Stephen F. Austin University: 348-357. [10333]
  • 65. Frost, Cecil Carlysle, III. 2000. Studies in landscape fire ecology and presettlement vegetation of the southeastern United States. Chaple Hill, NC: University of North Carolina. 620 p. Dissertation. [40279]
  • 121. LANDFIRE Rapid Assessment. 2007. Rapid assessment reference condition models. In: LANDFIRE. U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab; U.S. Geological Survey; The Nature Conservancy (Producers). Available: http://www.landfire.gov/models_EW.php [66533]
  • 206. Timoney, Kevin P. 1999. Threatened dry grasslands in the continental boreal forests of Wood Buffalo National Park: commentary. Canadian Journal of Botany. 77(7): 913-917. [33076]
  • 215. Viosca, Percy, Jr. 1931. Spontaneous combustion in the marshes of southern Louisiana. Ecology. 12(2): 439-443. [14582]
  • 219. Ward, P. 1968. Fire in relation to waterfowl habitat of the delta marshes. In: Proceedings, annual Tall Timbers fire ecology conference; 1968 March 14-15; Tallahassee, FL. No. 8. Tallahassee, FL: Tall Timbers Research Station: 255-267. [18932]
  • 231. Willard, E. Earl; Wakimoto, Ronald H.; Ryan, Kevin C. 1995. Vegetation recovery in sedge meadow communities within the Red Bench Fire, Glacier National Park. In: Cerulean, Susan I.; Engstrom, R. Todd, eds. Fire in wetlands: a management perspective: Proceedings, 19th Tall Timbers fire ecology conference; 1993 November 3-6; Tallahassee, FL. No. 19. Tallahassee, FL: Tall Timbers Research Station: 102-110. [25778]
  • 232. Wills, Robin. 2006. Central Valley bioregion. In: Sugihara, Neil G.; van Wagtendonk, Jan W.; Shaffer, Kevin E.; Fites-Kaufman, Joann; Thode, Andrea E., eds. Fire in California's ecosystems. Berkeley, CA: University of California Press: 295-320. [65547]
  • 11. Barry, W. James; Carle, David H.; Carle, Janet A. 2002. The use of prescribed fire in wetland restoration at Mono Lake Tufa State Reserve. In: Sugihara, Neil G.; Morales, Maria; Morales, Tony, eds. Fire in California ecosystems: integrating ecology, prevention and management: Proceedings of the symposium; 1997 November 17-20; San Diego, CA. Misc. Pub. No. 1. [Place of publication unknown]: Association for Fire Ecology: 263-272. [46209]
  • 88. Hann, Wendel; Havlina, Doug; Shlisky, Ayn; [and others]. 2005. Interagency fire regime condition class guidebook. Version 1.2, [Online]. In: Interagency fire regime condition class website. U.S. Department of Agriculture, Forest Service; U.S. Department of the Interior; The Nature Conservancy; Systems for Environmental Management (Producer). Variously paginated [+ appendices]. Available: http://www.frcc.gov/docs/1.2.2.2/Complete_Guidebook_V1.2.pdf [2007, May 23]. [66734]
  • 120. LANDFIRE Rapid Assessment. 2005. Reference condition modeling manual (Version 2.1), [Online]. In: LANDFIRE. Cooperative Agreement 04-CA-11132543-189. Boulder, CO: The Nature Conservancy; U.S. Department of Agriculture, Forest Service; U.S. Department of the Interior (Producers). 72 p. Available: http://www.landfire.gov/downloadfile.php?file=RA_Modeling_Manual_v2_1.pdf [2007, May 24]. [66741]
  • 179. Robertson, Morgan M. 1997. Prescribed burning as a management and restoration tool in wetlands of the upper Midwest. In: Restoration and reclamation review: Student on-line journal (Hort 5015/5071): Vol. 2-spring 1997: restoration techniques. Available: http://www.hort.agri.umn.edu/h5015/97papers/robertson.html [2007, December 18]. [68900]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Successional Status

More info on this topic.

More info for the terms: bog, density, eruption, frequency, marsh, presence, ramet, rhizome, succession

In open wetland and aquatic communities, broadleaf cattail is considered an early- to late-seral species [76]. However, in moist to wet forest or woodland communities, broadleaf cattail growth is restricted to early-seral sites that follow canopy-opening disturbances [22,54,78]. Broadleaf cattail's persistent seed bank allows for rapid colonization of disturbed sites, which partially explains why broadleaf cattail is considered an invasive or weedy species by some [76,211,228].

General descriptions: Most often, broadleaf cattail is described in early-seral communities. It is considered an early-seral species in bogs of Michigan [216]. It is a dominant emergent in early successional stages in low- and high-nutrient sites in oxbow lakes along the Athabasca River in Alberta [132]. The broadleaf cattail type is described as an "early successional wetland community" at low-elevation sites of southeastern Idaho and Utah [169]. In northwestern Montana, broadleaf cattail is described as a "pioneer species that tends to form a relatively stable type" [18].

Shade tolerance: Broadleaf cattail is shade intolerant [116], and full light conditions are most conducive to seed germination [19,191]. A review reported that shade levels of 40%, 60%, and 90% reduced broadleaf cattail growth by 60%, 80%, and 90%, respectively, when compared to full sun. Broadleaf cattail often died after 30 months in 90% shade [102]. Broadleaf cattail seedling height was lower in 33% full sun than in full sun conditions when grown from seed collected from North Bay Park in Michigan. After 84 days in the greenhouse, seedlings averaged a little over 24 inches (60 cm) under shade cloth and a little over 33 inches (85 cm) in full sun [224].

Primary succession: Broadleaf cattail appears early in the primary succession of open water and newly-deposited substrates resulting from avalanche and volcanic flows.

Hydrarch succession is the process by which shallow water species succeed and eventually replace deep water forms [226]. In open water succession, broadleaf cattail is typically present in the emergent vegetation stage following stages dominated by submerged leaf and floating leaf species. The submerged and floating leaf stages of hydrarch succession in floodplains, deltas, and oxbow lakes of Alberta are typically dominated by pondweed (Potamogeton spp.) and pond-lily (Nuphar spp.), respectively. Broadleaf cattail is common in the next stage. Eventually sites succeed to sedge meadows that are eventually colonized by cottonwoods (Populus spp.) and willows (Salix spp.) (Raup, cited in [159]),[130,214]. Very similar succession is described on Steeny Kill Lake in New Jersey [168], swamps of northwestern Minnesota [55], peatlands of Dane County, Wisconsin [63], and in Gulf Coast marshes of Louisiana and Texas [136], although important species within the submerged, floating leaf, and emergent stages are often different. Time frames for successional turnover were not discussed.

Debris flow succession: New substrates resulting from volcanic and avalanche debris flows may be colonized by broadleaf cattail as early as 1 year after deposition. On mud flows created from a slurry of rock, sand, mud, and organic material that melted with the Mount St Helens eruption, broadleaf cattail was present within 1 year of eruption [87]. Broadleaf cattail wetlands were also found on new pumice substrates north of the Mount St Helens crater 14 years after eruption [208]. On debris avalanche deposits along the North Fork Toutle River Valley caused by the same eruption, broadleaf cattail frequency was 5% three years after the eruption. Nine years after eruption, frequency had increased to19%. Twenty years after eruption, frequency had decreased to 2% [38].

Secondary succession: Broadleaf cattail rapidly colonizes moist to wet disturbed sites. Often broadleaf cattail is absent before disturbances but appears soon after canopy opening. Broadleaf cattail's persistent seed bank is likely important in the rapid colonization of disturbed sites.

General: In West Virginia wetland communities, broadleaf cattail was often associated with recent disturbance [59]. In bogs of northern lower Michigan, reed (Phragmites spp.)-cattail vegetation is common on sites "greatly disturbed" by fire or trampling. In Smith's Bog, broadleaf cattail was abundant in disturbed agricultural areas, but after farms were abandoned, broadleaf cattail dominance decreased [68]. Along the Saugus River in Wakefield, Massachusetts, the density and composition of disturbed broadleaf cattail marshes were not different from undisturbed marshes 1 year after power line construction (P>0.05) [167]. Broadleaf cattail colonized newly-deposited sand on Minnesota Point in Lake Superior within 1 year of dredging. Seedlings appeared 1 year after dredging, and in the next growing season, there were 9 broadleaf cattail seedlings/10 m² at a 10-foot (3 m) distance from the bay shore. Four years after dredging, the sand fill was dominated by a dense willow thicket and broadleaf cattail marsh [119].

Broadleaf cattail densities and population dynamics were compared in developing and maturing seral communities in Lawrence Lake area of Barry County, Michigan. Broadleaf cattail density was 10.4 ramets/m² in open marshes dominated by short-statured vegetation exposed to full sun and wind conditions. Density was greater, 21 ramets/m², in monotypic broadleaf cattail stands sheltered from wind. In adjacent woodlands dominated by red-osier dogwood (Cornus sericea subsp. sericea) and willows, broadleaf cattail density was much lower, 4.8 ramets/m². Broadleaf cattail growing-season mortality was lowest in open marsh and greatest in woodland communities. Researchers indicated that woodland ramet mortality was likely due to decreased light availability. In open marsh habitats, overwinter mortality was 2.5 to 4 times greater than in monotypic cattail stands and woodlands, respectively. Lack of protection from weather likely caused this discrepancy in overwinter mortality. Broadleaf cattail's presence in woodland communities was maintained by vegetative reproduction from the broadleaf cattail marsh [78].

Logging: In the Clay Belt of northeastern Ontario and western Quebec, broadleaf cattail occurred in ruts created by logging equipment in wetland black spruce (Picea mariana) stands. Forests were logged an average of 9.3 years before the study. Sites were mesotrophic, high in pH and nitrogen, and dominated by speckled alder (Alnus incana subsp. rugosa) and cottonwood [22].

Fire: Broadleaf cattail occurred in burned baldcypress (Taxodium distichum var. distichum)-dominated Pocomoke River Swamps on the eastern shore of Maryland. Broadleaf cattail clumps and monotypic stands occurred on shallow burned sites. Researchers noted that broadleaf cattail is a pioneer "fire weed" in postfire hydrarch succession [15]. Time since fire was not reported. Similar findings of broadleaf cattail in early postfire communities are presented in Fire Effects.

Grazing/trampling: Broadleaf cattail abundance can be reduced by common muskrat and livestock grazing. Common muskrats feed extensively on broadleaf cattail roots and rhizomes. Common muskrat populations can affect successional development and productivity in broadleaf cattail stands [37]. In a wetland north of Cambridge, Maryland, a researcher observed heavy broadleaf cattail feeding by common muskrats. Twelve years after heavy use, the broadleaf cattail marsh was converted to green arrow arum (Peltandra virginica)-dominated vegetation. Extensive common muskrat feeding converted solid broadleaf cattail rhizome mats to unconsolidated, anoxic, organic substrates, and water levels were lowered by 2 to 6 inches (5-15 cm) [66]. Additional information is available in Common muskrats.

Although broadleaf cattail is not considered particularly palatable to livestock, it may be consumed when water levels drop and/or other upland forage is unavailable. Grazing and trampling can reduce broadleaf cattail abundance. In northwestern Montana, heavy livestock use may convert broadleaf cattail communities to a Nebraska sedge (Carex nebrascensis) type [18]. In wetlands of southeastern Alberta, heavy cattle grazing and trampling killed nearly all broadleaf cattail seedlings on exposed mud. Trampling did not affect established stands. The researcher concluded that "broadleaf cattail as an established emergent is little affected by cattle, but as a moist soil stand it is often badly trampled" [111].

  • 18. Boggs, Keith; Hansen, Paul; Pfister, Robert; Joy, John. 1990. Classification and management of riparian and wetland sites in northwestern Montana. Draft Version 1. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station, Montana Riparian Association. 217 p. [8447]
  • 15. Beaven, George Francis; Oosting, Henry J. 1939. Pocomoke Swamp: a study of a cypress swamp on the eastern shore of Maryland. Bulletin of the Torrey Botanical Club. 66: 376-389. [14507]
  • 19. Bonnewell, V.; Koukkari, W. L.; Pratt, D. C. 1983. Light, oxygen, and temperature requirements for Typha latifolia seed germination. Canadian Journal of Botany. 61: 1330-1336. [17671]
  • 22. Brumelis, G.; Carleton, T. J. 1989. The vegetation of post-logged black spruce lowlands in central Canada. II. Understory vegetation. Journal of Applied Ecology. 26: 321-339. [7864]
  • 37. Curtis, John T. 1959. Aquatic communities. In: Curtis, John T. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press: 385-401. [60531]
  • 38. Dale, Virginia H.; Campbell, Daniel R.; Adams, Wendy M.; Crisafulli, Charles M.; Dains, Virginia I.; Frenzen, Peter M.; Holland, Robert F. 2005. Plant succession on the Mount St. Helens debris-avalanche deposit. In: Dale, V. H.; Swanson, F. J.; Crisafulli, C. M., eds. Ecological responses to the 1980 eruptions of Mount St. Helens. New York: Springer: 59-74. [61208]
  • 54. Ewel, Katherine Carter. 1984. Effects of fire and wastewater on understory vegetation in cypress domes. In: Ewel, Katherine Carter; Odum, Howard T., eds. Cypress swamps. Gainesville, FL: University of Florida Press: 119-126. [14845]
  • 55. Ewing, J. 1924. Plant successions of the brush-prairie in north-western Minnesota. Journal of Ecology. 12: 238-266. [11122]
  • 59. Fortney, Ronald H. 2000. Plant communities of West Virginia wetlands. West Virginia Academy of Science. 72(3): 41-54. [68447]
  • 63. Frolik, A. L. 1941. Vegetation on the peat lands of Dane County, Wisconsin. Ecological Monographs. 11(1): 117-140. [16805]
  • 66. Garbisch, Edgar. 1994. The results of muskrat feeding on cattails in a tidal freshwater wetland. Wetland Journal. 6(1): 14-15. [22800]
  • 68. Gates, Frank C. 1942. The bogs of northern Lower Michigan. Ecological Monographs. 12(3): 213-254. [10728]
  • 76. Grace, James B.; Harrison, Janet S. 1986. The biology of Canadian weeds. 73. Typha latifolia L., Typha angustifolia L. and Typha x glauca Godr. Canadian Journal of Plant Science. 66: 361-379. [17673]
  • 78. Grace, James B.; Wetzel, Robert G. 1981. Phenotypic and genotypic components of growth and reproduction in Typha latifolia: experimental studies in marshes of differing successional maturity. Ecology. 62(3): 789-801. [68539]
  • 87. Halpern, Charles B.; Harmon, Mark E. 1983. Early plant succession on the Muddy River mudflow, Mount St. Helens, Washington. The American Midland Naturalist. 110(1): 97-106. [8870]
  • 102. Holm, Leroy; Doll, Jerry; Holm, Eric; Pancho, Juan; Herberger, James. 1997. 99: Typha angustifolia L. and Typha latifolia L. In: World weeds: Natural histories and distribution. New York: John Wiley and Sons, Inc.: 869-879. [68848]
  • 111. Keith, Lloyd B. 1961. A study of waterfowl ecology on small impoundments in southeastern Alberta. Wildlife Monographs. 6: 1-88. [4501]
  • 116. Kudish, Michael. 1992. Adirondack upland flora: an ecological perspective. Saranac, NY: The Chauncy Press. 320 p. [19376]
  • 119. Lakela, Olga. 1939. A floristic study of a developing plant community on Minnesota Point, Minnesota. Ecology. 20(4): 544-552. [67538]
  • 130. Lewis, Francis J.; Dowding, Eleanor S.; Moss, E. H. 1928. The vegetation of Alberta: II. The swamp, moor and bog forest vegetation of central Alberta. Journal of Ecology. 16: 19-70. [12798]
  • 132. Lieffers, V. J. 1983. Growth of Typha latifolia in boreal forest habitats, as measured by double sampling. Aquatic Botany. 15: 335-348. [17670]
  • 136. Lynch, John J.; O'Neil, Ted; Lay, Daniel W. 1947. Management significance of damage by geese and muskrats to Gulf Coast marshes. Journal of Wildlife Management. 11(1): 50-76. [14559]
  • 159. Moss, E. H. 1955. The vegetation of Alberta. Botanical Review. 21(9): 493-567. [6878]
  • 167. Nickerson, Norton H.; Dobberteen, Ross A.; Jarman, Nancy M. 1989. Effects of power-line construction on wetland vegetation in Massachusetts, USA. Environmental Management. 13(4): 477-483. [68469]
  • 168. Niering, William A. 1953. The past and present vegetation of High Point State Park, New Jersey. Ecological Monographs. 23(2): 127-148. [64426]
  • 169. Padgett, Wayne G.; Youngblood, Andrew P.; Winward, Alma H. 1989. Riparian community type classification of Utah and southeastern Idaho. R4-Ecol-89-01. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Region. 191 p. [11360]
  • 191. Sifton, H. B. 1959. The germination of light-sensitive seeds of Typha latifolia L. Canadian Journal of Botany. 37: 719-739. [17668]
  • 208. Titus, Jonathan H.; Titus, Priscilla J.; del Moral, Roger. 1999. Wetland development in primary and secondary successional substrates fourteen years after the eruption of Mount St. Helens, Washington, USA. Northwest Science. 73(3): 186-204. [40769]
  • 214. van der Valk, A. G.; Bliss, L. C. 1971. Hydrarch succession and net primary production of oxbow lakes in central Alberta. Canadian Journal of Botany. 49(7): 1177-1199. [3244]
  • 216. Voss, Edward G. 1972. Michigan flora. Part I: Gymnosperms and monocots. Bloomfield Hills, MI: Cranbrook Institute of Science; Ann Arbor, MI: University of Michigan Herbarium. 488 p. [11471]
  • 224. Weihe, Paul Edward. 1993. The effects of environmental conditions on competition between purple loosestrife (Lythrum salicaria L.) and broad-leaved cattail (Typha latifolia L.). Ypsilanti, MI: Eastern Michigan University. 61 p. Thesis. [68576]
  • 226. Wells, B. W. 1928. Plant communities of the coastal plain of North Carolina and their successional relations. Ecology. 9(2): 230-242. [9307]
  • 228. Werner, Katherine J.; Zedler, Joy B. 2002. How sedge meadow soils, microtopography, and vegetation respond to sedimentation. Wetlands. 22(3): 451-466. [60630]
  • 211. U.S. Department of Agriculture, Forest Service, Eastern Region. 2004. Eastern Region invasive plants ranked by degree of invasiveness, [Online]. In: Noxious weeds and non-native invasive plants. Section 3: Invasive plants. Milwaukee, WI: Eastern Region (Producer). Available: http://www.fs.fed.us/r9/wildlife/range/weed/Sec3B.htm [2004, February 16]. [46748]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regeneration Processes

More info for the terms: achene, cover, density, eruption, frequency, litter, marsh, monoecious, natural, presence, ramet, rhizome, series

Broadleaf cattail regenerates vegetatively through rhizome sprouts and sexually through seed germination [189].

Pollination: Female broadleaf cattail flowers mature before male flowers, making cross pollination possible or even likely [10,82].

Breeding system: Broadleaf cattail is monoecious [5,72]. Heterozygosity and polymorphism levels suggest extremely low genetic variation in broadleaf cattail stands, but genetic differentiation exists between stands; ramets within a site are more similar than those between sites. Researchers indicate that self pollination and clonal growth have increased the genetic homogeneity of stands while increasing genetic differences between sites. Increased genetic diversity of broadleaf cattail occurred at the most polluted sites along a transect from Louisville, Kentucky, to Circleville, Ohio. Researchers were not sure that pollution levels caused the genetic differences [109].

Seed production: When broadleaf cattail flowers, abundant seed production is possible. A review reports that typically more than half of pollinated flowers set seed [102]. In controlled conditions, broadleaf cattail grown from seed produced flowers early in the second year of growth. From 10 spikes that averaged 7 inches (18 cm) long, an average of over 222,000 seeds/spike was produced [238].

Many studies report poor flower production by broadleaf cattail. Sexual reproduction was rare in broadleaf cattail vegetation on the west side of Lawrence Lake in south-central Barry County, Michigan. Of 1,779 marked shoots studied over 3 years, only 3 flowered [45]. Degree of shading or depth of submergence may affect flowering. In broadleaf cattail monocultures in experimental ponds at the University of Arkansas, broadleaf cattail flowered only when roots were not submerged. Researchers suggested that self shading in dense stands may inhibit flowering [75]. In a manmade pond at Michigan's W. K. Kellogg Biological Station, the percentage of broadleaf cattail flowering in a single year in September varied with water level. Unsubmerged plants did not flower. When submerged under 6 inches (15 cm) of water, 33% flowered, and in 20 inches (50 cm) of water, 11% flowered [80]. Perhaps a water level influence on flowering is related to the nonflooded or barely flooded conditions necessary for successful seed germination. For additional information on this topic, see Germination.

Seed dispersal: Broadleaf cattail seeds are transported by wind, water, and substrate movement. Achenes have numerous long slender hairs at the base that allow fruits to float on water and blow in the wind [172], and some report that achenes split or burst when they contact water [92,98]. Broadleaf cattail produces abundant seeds [58]. A review describes the release of broadleaf cattail fruits from the spike. When fruits are dry, protective portions of the pistil shrivel and hairs on the achene spread. Spreading hairs produce pressure that bursts inflorescences and releases fruits into the air [102]. Wind dispersal distances of broadleaf cattail seeds collected in Hockessin, Delaware, were calculated from timed descents made indoors. Seed mass averaged 0.05 mg. Seeds fell at 0.13 m/s, and the estimated lateral distance traveled in a 10 km/h wind was 154 feet (46.9 m) [144].

Seeds are also dispersed through soil movement when mud clings to animals or people [47]. Seeds may also be transported with portions of broadleaf cattail clones that are torn by wind, water, ice, or animals [6]. Often seeds remain attached to spikes through the winter and are dispersed in the spring, and in some cases seeds fail to disperse. Apfelbaum [6] observed submerged cattail spikes with hundreds of nearby seedlings.

Seed banking: Broadleaf cattail produces a persistent seed bank. Although there are no reports of how long broadleaf cattail seed remains viable in the soil, its emergence from soils in late-seral forests that have long been unsuitable broadleaf cattail habitat suggests long-term persistence or long-distance dispersal. In Washington, a small percentage of field-collected broadleaf cattail seed germinated after being stored in a freshwater canal for 60 months [33]. While dense broadleaf cattail seedlings often emerged from sites where broadleaf cattail was important [126,210], there were exceptions [48,210]. Most of the studies below used the emergence method to determine the density of broadleaf cattail seed in the soil. This method requires, but rarely assures, that ideal broadleaf cattail germination conditions are provided.

Depth, season, and vegetation type: Broadleaf cattail emergence from soil collected in the Hamilton Marshes of New Jersey's Delaware River wetlands varied with season of collection, depth of burial, and vegetation type. Through field experiments, researchers determined that more than half of broadleaf cattail emergents came from persistent seed banks and not recent seed rain. The greatest number of broadleaf cattail seedlings (15,060/m²) emerged from the top 0.8 inch (2 cm) of soil collected in March from vegetation dominated by calamus (Acorus calamus) and broadleaf cattail. Soils collected in June from the same depth and vegetation type had 2,340/m² broadleaf cattail seedlings emerge. There were 5,060/m² and 2,150/m² broadleaf cattail seedlings in the top 0.8 inch of soils collected in March and June, respectively, in shrublands dominated by red maple (Acer rubrum), silky dogwood (Cornus amomum), and alder (Alnus spp.). Broadleaf cattail seedling emergence decreased with increasing soil depths, and no seedlings emerged from soil samples taken from depths greater than 5.9 inches (15 cm). More seedlings emerged on unprotected sites (53,000/m²) than on sites with seed rain excluded (38,700/m²). Although differences were not significant (P>0.05) [126], they suggest a persistent seed bank. For additional information on Leck and Simpson's [126] study, see Germination and Seedling establishment/growth.

High levels of seedlings or germinants are not always recovered from soils where broadleaf cattail is important. Few broadleaf cattails germinated from soils collected in eastern Tennessee mixed-deciduous forests. Soil samples collected in the spring from a site where broadleaf cattail frequency was 70% had 27±10 (SE) broadleaf cattail germinants. No seedlings germinated from summer-collected soils. From a site where broadleaf cattail frequency was 10%, there was only 1 germinant/m² from spring-collected soils [48].

Newly-colonized sites: Broadleaf cattail seed was recovered from new substrates resulting from the eruption of Mount St Helens. Seed banks develop soon after broadleaf cattail colonization [238]. In late September, soil samples were collected from newly-developed wetlands. No broadleaf cattail seedlings emerged from soil collected in wetlands where broadleaf cattail cover averaged 60%. In a wetland where broadleaf cattail cover averaged 90%, 126±145 (SD) seedlings/m² emerged from the top 2 inches (5 cm) of soil, and 1,088±1,609 seedlings/m² emerged from 2- to 4-inch (5-10 cm) depths. No broadleaf cattail seedlings emerged from soil samples that were not cold stratified. Researchers suspected that soil samples contained more broadleaf cattail seed than what emerged and that germination conditions were not ideal in the greenhouse [210].

Disturbed and late-seral forests: In south-central British Columbia, broadleaf cattail seeds emerged from undisturbed, 1-year-old "lightly burned", and 1-year-old clearcut Douglas-fir (Pseudotsuga menziesii) forests, although broadleaf cattail was not part of the existing vegetation. Broadleaf cattail seedlings emerged from soil samples collected from 5% of the quadrats in the undisturbed area, from 5% of lightly-burned quadrats, and from 2% of clearcut quadrats [195]. Few broadleaf cattail seedlings also emerged from the litter or top 0.8 inch (2 cm) of soil collected from 130- to 175-year-old mixed-conifer forests in eastern Oregon's Blue Mountains, although broadleaf cattail was not present in study plots or adjacent areas. Researchers suggested that broadleaf cattail seed survives in the soil until conditions are conducive to germination, allowing broadleaf cattail to rapidly occupy disturbed sites [202]. Low numbers of broadleaf cattail seedlings also emerged from soil collected in mature Douglas-fir and fir (Abies spp.) forests averaging 88 years or older in central Idaho [114].

Germination: Specific requirements necessary for broadleaf cattail germination are difficult to ascertain. Experimental studies indicate that light and warm temperatures are necessary for broadleaf cattail seed germination. However, studies involving flooding, leaf litter extract, and stratification effects on seed have produced conflicting results.

Broadleaf cattail seeds collected for 3 years from populations at 8,500 feet (2,600 m) elevation near Grand Lake, Colorado, failed to germinate. Researchers noted that broadleaf cattail had occupied the site for at least 12 years and that vegetative growth was vigorous [149]. Reasons for the variability in germination potential, requirements, and tolerances are unknown. Possibly broadleaf cattail seed viability is temporally, environmentally, ecotypically, and/or genotypically variable.

Cold stratification: As part of an extensive study of broadleaf cattail ecotypic population differences, McNaughton [147] found that broadleaf cattail seeds did not require a cold period before germinating, but the lowest temperature at which 50% germination occurred was lower in southern than northern populations. Broadleaf cattail seeds collected in soils from newly-developed wetlands on Mount St Helens only germinated in soils that were stratified (37 °F (3 °C)) for 12 weeks. No seedlings emerged in unstratified wetland soils [210].

Salinity: Choudhuri [27] found that broadleaf cattail germination percentages decreased with increasing salinity. No seeds germinated above 1 atm of osmotic pressure in natural salinity. For additional information on broadleaf cattail's tolerance of salt as a juvenile and adult plant, see Soil salinity.

Light, pH, temperature, oxygen, and ash: Broadleaf cattail seeds germinate best in warm temperatures and high light conditions [19,191,224]. Seeds germinate in acid, basic, or neutral pH conditions, and ash extracts have increased broadleaf cattail germination [178]. Reduced oxygen levels through the manipulation of gases in the air or through submersion have also increased broadleaf cattail germination success [191].

Broadleaf cattail seeds collected from North Bay Park on Ford Lake Reservoir shores in Washtenaw County, Michigan, germinated better in light than in dark conditions, better at 77 °F (25 °C) than at 68 °F (20 °C), and better when submerged than when exposed. Exposed seed germination, regardless of temperature or light exposure, ranged from 0.8% to 5%. Germination was best, 79.2%, when seeds were submerged, in the light, and kept at 77 °F (25 °C) [224].

Germination increased with increasing temperatures for broadleaf cattail seeds collected in May and October from Carlos Avery Wildlife Management Area, Minnesota. Maximum germination percentages occurred at the maximum temperature tested, 95 °F (35 °C). No seeds germinated at 50 °F (10 °C). Seeds exposed to cold temperatures before exposure to 95 °F (35 °C) temperatures had lower germination percentages than seeds kept at room temperature. Germination did not occur when seeds were exposed to low oxygen levels of 1.0 mg/L, and at least 10 hours of continuous red light was required for maximum germination. Researchers suggested that broadleaf cattail germination in the field would be most likely at the surface of saturated soils [19].

Optimum broadleaf cattail germination temperatures were 77 to 86 °F (25-30 °C), and seed crops responded differently to reduced and normal oxygen levels in studies conducted in Ontario. Germination rates were slower and percentages were reduced at 68 °F (20 °C) and 95 °F (35 °C). Seeds immersed in water germinated better than those kept moist. When moist seeds were exposed to reduced oxygen levels (2%), germination percentages equaled those of immersed seeds. Light exposure increased germination. The light intensity required for germination was low, but critical intensities varied with individual seeds. Seeds in full light had 99% germination. In containers wrapped with 3 layers of herbarium paper, germination was 97%, and when wrapped with tin foil, germination was 5%. Germination studies spanned many years, and differences were found among broadleaf cattail seed crops. Seeds collected in 4 of 7 years had increased germination in low oxygen environments, but 3 crops showed little to no apparent difference with oxygen levels changes [191].

Collection time affected the germination of broadleaf cattail seed collected in November and May in central Alberta. Less than 1% of fall-collected seeds germinated in light and distilled water, but 90% of seeds collected in May germinated. Germination in light (81-90%) was significantly higher than in the dark (15-73%, P<0.01). Germination in the dark increased when broadleaf cattail ash was added to distilled water. Germination was not affected by pH levels of 4, 7, or 12. Researchers suggested that high light levels and ash on burned sites may favor broadleaf cattail seed germination. Researchers also suggested that low humidity levels during seed storage may have affected viability [178], but spring collected seeds may have benefited from natural stratification.

Flooding: Many controlled experiments indicate that broadleaf cattail seeds germinate well in submerged or flooded conditions; however, field observations suggest regeneration from seed is restricted to nonflooded substrates [189]. Beule [16] indicated that field observations made in southeastern Wisconsin did not agree with laboratory reports of broadleaf seed germination in flooded conditions. Only once did Beule find broadleaf cattail seedlings in areas where germination may have occurred under shallow water. All other field observations suggested that germination was restricted to exposed substrates [16]. Differences between laboratory and field observations may relate to light requirements. The quality and murkiness of water in the field and water used in the laboratory were likely different, and associated vegetation cover in the field was not likely mimicked in laboratory studies.

Broadleaf cattail seeds collected near Huntley, Montana, germinated at very low percentages regardless of pH or temperature treatments. Only when seed coats were ruptured along the edge were high germination percentages achieved. Broadleaf cattail seeds with ruptured seed coats germinated under 30 inches (76 cm) of water and grew to the surface [238]. Broadleaf cattail germination percentages were greatest, about 43%, at 16 inches (40 cm) deep and lowest, approximately 16%, when unflooded at the Aquatic Environmental Research Facility in Lewisville, Texas. Germination percentages at 31-inch (80 cm) and 39-inch (100 cm) depths were about 25% [188].

Emergence of broadleaf cattail from reclaimed coal mine wetland soils in Perry County, Illinois, was better when samples were submerged in 0.8 inch (2 cm) of water than when kept moist [31]. Flooding soils collected from the Hamilton Marshes of New Jersey's Delaware River wetlands with 1.2 to 1.6 inches (3-4 cm) of water did not significantly affect broadleaf cattail germination (P>0.05). Researchers noted that broadleaf cattail emergence in the field was substantially less than in the greenhouse. Frequency of broadleaf cattail seedlings in the field ranged from 0 to 47% over a 2-year period in 2 vegetation types [126]. See Seed banking for more on seedling emergence results from Leck and Simpson's [126] study.

Nutrients and extracts: Some studies report differences in percent germination and germination rates when broadleaf cattail seeds are exposed to leaf litter extracts and nutrients. Germination rate increased but total percent germination was not different when seeds from the northern Florida Everglades were kept moist with Everglades water rather than distilled water. Everglades water with low, medium, and high levels of total phosphate was tested [198].

Germination was nearly a complete failure when seeds collected from broadleaf cattail marshes near Syracuse, New York, were kept moist with broadleaf cattail leaf extracts. In distilled water, broadleaf cattail germination was 90.8% after only 2 days. The researcher described the inhibition as "autotoxic feedback", a process by which seedling viability decreases with accumulations of toxic parent residues [148]. Germination of broadleaf cattail seeds from Washington County, Arkansas, was inhibited by 3% broadleaf cattail leaf extract concentrations, but inhibition was due to the development of water molds. There were no significant differences in germination of seeds planted in pots with (82%) or without (86%) adult broadleaf cattail (P>0.05). Light levels were high (81% full sun) and litter accumulations were low in the pots, which is not representative of a natural broadleaf cattail stand [74]. In natural broadleaf cattail marshes in Crawford County, Pennsylvania, light was less than 3% at the soil surface [23].

Broadleaf cattail hybrids: Increased sediments and flooding reduced broadleaf cattail × narrow-leaved cattail germination percentages. Germination of broadleaf cattail × narrow-leaved cattail seed collected from Larson Marsh in Story County, Iowa, decreased by 60% to 90% when 2 to 4 mm of sediment were added to the soil surface [218]. In the greenhouse, broadleaf cattail × narrow-leaved cattail and broadleaf cattail germination was 15% and 16%, respectively, in 16 inches (41 cm) of water. Germination was best in 1 inch (2.5 cm) of water, and germination percentages decreased with increasing water depths [225].

Seedling establishment/growth: Broadleaf cattail seedlings are extremely small when compared to seedlings of associated vegetation. Drawings of typical broadleaf cattail seedlings are provided by Leck and Simpson [125]. After germination, broadleaf cattail produces 2 to 4 small leaves and 2 to 6 floating leaves before producing erect leaves. Once shoots reach 14 to 18 inches (35-45 cm) tall, rhizome growth begins (Holm and others as cited in [155]). Flooding and sediments can affect seedling survivorship and growth.

Flooding: Some indicate that broadleaf cattail seedling establishment is most likely on nonflooded substrates [16,189]. However, Yeo [238] observed that nearly all broadleaf cattail seedlings in the field were submerged in early growth. At the Aquatic Environmental Research Facility in Lewisville, Texas, broadleaf cattail seedling biomass was measured 10 weeks after germination at 0- to 47-inch (120 cm) depths. Seedling biomass was greatest at 7.9 inches (20 cm) and least at 47 inches (120 cm). Unflooded conditions produced seedling biomass greater than flooding with 24 or more inches (>60 cm) [188].

Hybrid seedlings/growth: Broadleaf cattail × narrow-leaved cattail seedling survivorship was much lower in 1 cm of sediment than when no sediment was present, and younger seedlings were more sensitive to sedimentation than older (26-37 days) seedlings. Survival decreased when over half of the shoot was covered. Survivorship increased when older, larger seedlings received small amounts of sediment. Sediment loads of up to 1.6 inches (4 cm) did not affect adult plant densities [218].

Growth: Typical broadleaf cattail growth and development were summarized after 3 years of studies on the west side of Lawrence Lake in Michigan. There are 3 shoot emergence pulses/year; one occurs in the early spring, with spring shoots dying by late fall. In midsummer another pulse of growth occurs, and 70% to 80% of shoots die in the fall. The last growth pulse produces 80% to 90% of the shoots that will resume growth in spring [45]. The rhizome is the most long-lived broadleaf cattail structure; it survives up to 2 years (Westlake, cited in [45]). Broadleaf cattail growth and production can be affected by soil moisture regimes and associated species presence.

Broadleaf cattail biomass production and height growth were greatest for continuously flooded seedlings in a greenhouse experiment. Researchers collected broadleaf cattail seed in March from freshwater wetlands along the Mississippi River in Tennessee. Seedling biomass production and height growth were significantly lower in periodic drought conditions than in continuously flooded conditions (P<0.001) [131].

At the W. K. Kellogg Biological Station in Michigan, broadleaf cattail shoot density was 32% lower when growing with narrow-leaved cattail than when growing in a monoculture [81].

Vegetative regeneration: Rhizome growth is important to broadleaf cattail regeneration. Rhizome dispersal may occur when portions of a clone are separated by wind, water, ice, or animals [6]. Dispersal is also likely through tillage and substrate movement [47].

Broadleaf cattail is highly productive through clonal growth. Broadleaf cattail clones can occupy 58 m² two years after germination [77]. Holm and others [102] reported in a review that a single broadleaf cattail colony was 54 m² after 2 growing seasons and produced a total rhizome length of 1,600 feet (480 m). A plant grown from seed produced rhizomes that reached a diameter of 10 feet (3 m) in a single growing season [238]. Nearly monotypic broadleaf cattail stands are multiclonal [109]. Broadleaf cattail ramets typically die within a year. If the ramet flowered, it was very unlikely to live beyond 1 year. In undisturbed broadleaf cattail stands, ramets were not over 3 years old [78].

In many cases, vegetative regeneration predominates over sexual reproduction. Some indicate that seedlings rarely occur in established broadleaf cattail stands [78] and that rhizome production and growth are the primary methods for increasing stand size [44]. Researchers collected seed for 3 years from an established high-elevation broadleaf cattail stand near Grand Lake, Colorado. No seed germinated, but vegetative growth was described as vigorous [149]. A total of 1,765 broadleaf cattail shoots were monitored in the western marsh of Lawrence Lake in south-central Michigan over a 2-year period. There were no seedlings, and only 2 shoots flowered. Researchers summarized that "through vigorous vegetative growth", a dense, monotypic broadleaf cattail stand produced a "tightly packed advancing front of ramets" that successfully excluded other plants [44]. After a series of field experiments, researchers concluded that broadleaf cattail "is exploitive in its ability to clone rapidly and colonize available space, is able to capture light effectively because of its high allocation to leaves and high leaf surface area, and as a result has a low allocation to sexual reproduction" [79].

  • 10. Bare, Janet E. 1979. Wildflowers and weeds of Kansas. Lawrence, KS: The Regents Press of Kansas. 509 p. [3801]
  • 33. Comes, R. D.; Bruns, V. F.; Kelley, A. D. 1978. Longevity of certain weed and crop seeds in fresh water. Weed Science. 26(4): 336-344. [50697]
  • 82. Great Plains Flora Association. 1986. Flora of the Great Plains. Lawrence, KS: University Press of Kansas. 1392 p. [1603]
  • 98. Hickman, James C., ed. 1993. The Jepson manual: Higher plants of California. Berkeley, CA: University of California Press. 1400 p. [21992]
  • 5. Anderson, J. P. 1959. Flora of Alaska and adjacent parts of Canada. Ames, IA: Iowa State University Press. 543 p. [9928]
  • 6. Apfelbaum, Steven I. 1985. Cattail (Typha spp.) management. Natural Areas Journal. 5(3): 9-17. [68427]
  • 16. Beule, John D. 1979. Control and management of cattails in southeastern Wisconsin wetlands. Tech. Bull No. 112. Madison, WI: Department of Natural Resources. 40 p. [14574]
  • 19. Bonnewell, V.; Koukkari, W. L.; Pratt, D. C. 1983. Light, oxygen, and temperature requirements for Typha latifolia seed germination. Canadian Journal of Botany. 61: 1330-1336. [17671]
  • 23. Bunker, Daniel Emerton. 2004. The application of competition theory to invaders and biological control: a test case with purple loosestrife (Lythrum salicaria), broad-leaved cattail (Typha latifolia), and a leaf-feeding beetle (Galerucella calmariensis). Pittsburgh, PA: University of Pittsburgh. 116 p. Dissertation. [68579]
  • 27. Choudhuri, G. N. 1968. Effect of soil salinity on germination and survival of some steppe plants in Washington. Ecology. 49(3): 465-471. [623]
  • 31. Cole, C. Andrew. 1991. The seedbank of a young surface mine wetland. Wetlands Ecology and Management. 1(3): 173-184. [19468]
  • 44. Dickerman, Joyce A.; Wetzel, Robert G. 1985. Clonal growth in Typha latifolia: population dynamics and demography of the ramets. Journal of Ecology. 73(2): 535-552. [68532]
  • 45. Dickerman, Joyce Ann. 1982. The pattern and process of clonal growth in a common cattail (Typha latifolia L.) population. East Lansing, MI: Michigan State University. 95 p. Dissertation. [68577]
  • 47. DiTomaso, Joseph M.; Healy, Evelyn A. 2003. Aquatic and riparian weeds of the West. Publication 3421. Davis, CA: University of California, Agriculture and Natural Resources. 442 p. [48834]
  • 48. Dobberpuhl, J. 1980. Seed banks of forest soils in east Tennessee. Knoxville, TN: University of Tennessee. 219 p. Thesis. [46755]
  • 72. Godfrey, Robert K.; Wooten, Jean W. 1979. Aquatic and wetland plants of southeastern United States: Monocotyledons. Athens, GA: The University of Georgia Press. 712 p. [16906]
  • 74. Grace, James B. 1983. Autotoxic inhibition of seed germination by Typha latifolia: an evaluation. Oecologia. 59(2-3): 366-369. [68538]
  • 75. Grace, James B. 1989. Effects of water depth on Typha latifolia and Typha domingensis. American Journal of Botany. 76(5): 762-768. [1822]
  • 77. Grace, James B.; Wetzel, Robert G. 1981. Habitat partitioning and competitive displacement in cattails (Typha): experimental field studies. The American Naturalist. 118(4): 463-474. [17674]
  • 78. Grace, James B.; Wetzel, Robert G. 1981. Phenotypic and genotypic components of growth and reproduction in Typha latifolia: experimental studies in marshes of differing successional maturity. Ecology. 62(3): 789-801. [68539]
  • 79. Grace, James B.; Wetzel, Robert G. 1982. Niche differentiation between two rhizomatous plant species: Typha latifolia and Typha angustifolia. Canadian Journal of Botany. 60: 46-57. [17683]
  • 80. Grace, James B.; Wetzel, Robert G. 1982. Variations in growth and reproduction within populations of two rhizomatous plant species: Typha latifolia and Typha angustifolia. Oecologia. 53: 258-263. [17682]
  • 81. Grace, James B.; Wetzel, Robert G. 1998. Long-term dynamics of Typha populations. Aquatic Botany. 61(2): 137-146. [68452]
  • 92. Harrington, H. D. 1964. Manual of the plants of Colorado. 2nd ed. Chicago, IL: The Swallow Press, Inc. 666 p. [6851]
  • 102. Holm, Leroy; Doll, Jerry; Holm, Eric; Pancho, Juan; Herberger, James. 1997. 99: Typha angustifolia L. and Typha latifolia L. In: World weeds: Natural histories and distribution. New York: John Wiley and Sons, Inc.: 869-879. [68848]
  • 109. Keane, Brian; Pelikan, Stephan; Toth, Greg P.; Smith, M. Kate; Rogstad, Steven H. 1999. Genetic diversity of Typha latifolia (Typhaceae) and the impact of pollutants examined with tandem-repetitive DNA probes. American Journal of Botany. 86(9): 1226-1238. [68458]
  • 114. Kramer, Neal B.; Johnson, Frederic D. 1987. Mature forest seed banks of three habitat types in central Idaho. Canadian Journal of Botany. 65: 1961-1966. [3961]
  • 125. Leck, Mary A.; Simpson, Robert L. 1993. Seeds and seedlings of the Hamilton Marshes, a Deleware River tidal freshwater wetland. Proceedings of the Academy of Natural Sciences of Philadelphia. 144: 267-281. [68544]
  • 126. Leck, Mary Allessio; Simpson, Robert L. 1987. Seed bank of a freshwater tidal wetland: turnover and relationship to vegetation change. American Journal of Botany. 74(3): 360-370. [66921]
  • 131. Li, Shuwen; Pezeshki, S. Reza; Goodwin, Shirlean. 2004. Effects of soil moisture regimes on photosynthesis and growth in cattail (Typha latifolia). Acta Oecologica. 25(1-2): 17-22. [68462]
  • 144. Matlack, Glenn R. 1987. Diaspore size, shape, and fall behavior in wind-dispersed plant species. American Journal of Botany. 74(8): 1150-1160. [28]
  • 147. McNaughton, S. J. 1966. Ecotype function in the Typha community-type. Ecological Monographs. 36(4): 297-325. [17676]
  • 148. McNaughton, S. J. 1968. Autotoxic feedback in relation to germination and seedling growth in Typha latifolia. Ecology. 49(2): 367-369. [17684]
  • 149. McNaughton, S. J.; Cambell, R. S.; Freyer, R. A.; Mylroie, J. E.; Rodland, K. D. 1974. Photosynthetic properties and root chilling responses of altitudinal ecotypes of Typha latifolia L. Ecology. 55(1): 168-172. [68547]
  • 155. Mitich, Larry M. 2000. Common cattail, Typha latifolia L. Weed Technology. 14(2): 446-450. [68466]
  • 172. Pojar, Jim; MacKinnon, Andy, eds. 1994. Plants of the Pacific Northwest coast: Washington, Oregon, British Columbia and Alaska. Redmond, WA: Lone Pine Publishing. 526 p. [25159]
  • 178. Rivard, Paul G.; Woodard, Paul M. 1989. Light, ash, and pH effects on the germination and seedling growth of Typha latifolia (cattail). Canadian Journal of Botany. 67: 2783-2787. [14769]
  • 188. Sharp, Jessica Little. 2002. Managing cattail (Typha latifolia) growth in wetland systems. Denton, TX: University of North Texas. 53 p. Thesis. [68568]
  • 189. Shay, Jennifer M.; Shay, C. Thomas. 1986. Prairie marshes in western Canada, with specific reference to the ecology of five emergent macrophytes. Canadian Journal of Botany. 64: 443-454. [18397]
  • 191. Sifton, H. B. 1959. The germination of light-sensitive seeds of Typha latifolia L. Canadian Journal of Botany. 37: 719-739. [17668]
  • 195. Stark, Kaeli E.; Arsenault, Andre; Bradfield, Gary E. 2006. Soil seed banks and plant community assembly following disturbance by fire and logging in interior Douglas-fir forests of south-central British Columbia. Canadian Journal of Botany. 84(10): 1548-1560. [65962]
  • 198. Stewart, Herbert; Miao, Shi Li; Colbert, Marsha; Carraher, Charles E., Jr. 1997. Seed germination of two cattail (Typha) species as a function of Everglades nutrient levels. Wetlands. 17(1): 116-122. [68474]
  • 202. Strickler, Gerald S.; Edgerton, Paul J. 1976. Emergent seedlings from coniferous litter and soil in eastern Oregon. Ecology. 57: 801-807. [2039]
  • 210. Tu, Mandy; Titus, Jonathan H.; Tsuyuzaki, Shiro; del Moral, Roger. 1998. Composition and dynamics of wetland seed banks on Mount St. Helens, Washington, USA. Folia Geobotanica. 32(1): 3-16. [68516]
  • 218. Wang, Shih-Chin; Jurik, Thomas W.; van der Valk, Arnold G. 1994. Effects of sediment load on various stages in the life and death of cattail (Typha X glauca). Wetlands. 14(3): 166-173. [68892]
  • 224. Weihe, Paul Edward. 1993. The effects of environmental conditions on competition between purple loosestrife (Lythrum salicaria L.) and broad-leaved cattail (Typha latifolia L.). Ypsilanti, MI: Eastern Michigan University. 61 p. Thesis. [68576]
  • 225. Weller, Milton W. 1975. Studies of cattail in relation to management for marsh wildlife. Iowa State Journal of Research. 49(4): 383-412. [18158]
  • 238. Yeo, R. R. 1964. Life history of common cattail. Weeds. 12: 284-288. [17666]
  • 58. Flora of North America Association. 2008. Flora of North America: The flora, [Online]. Flora of North America Association (Producer). Available: http://www.fna.org/FNA. [36990]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth Form (according to Raunkiær Life-form classification)

More info on this topic.

More info for the terms: geophyte, helophyte

RAUNKIAER [177] LIFE FORM:
Geophyte
Helophyte
  • 177. Raunkiaer, C. 1934. The life forms of plants and statistical plant geography. Oxford: Clarendon Press. 632 p. [2843]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Form

More info for the term: graminoid

Graminoid

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The structure of cattail stands as it is, with upright leaves, high leaf area, balanced horizontal and vertical distribution of leaf area and shifts in leaf angle are all factors which permit monoculture success. An open, generously sunny habitat and abundant moisture can provide the setting for maximum cattail production.

Typha plants are mined by caterpillars of the moths Arzama opbliqua and Nonagria oblonga (Klots 1966). Aphids and Colandra pertinaux (the snout beetle) also feed on Typha leaves and stems. The stems may have many species of pupa living within them (Klots 1966). The cattail rhizomes provide food to mammals such as the muskrat. The grazing of muskrats may greatly influence cattail communities. A cycling population of muskrats may reach such a density so as to totally set back a cattail stand for the season. These "eat outs" are important to maintain open water in a balanced system. Muskrats utilize leaves and stems for houses and eat the rhizomes (Zimmerman pers. comm.). Cattail fruits provide nesting material for terrestrial birds and dry stems may be used by aquatic birds.

Above ground portions die in the late fall and rhizomes overwinter. In Wisconsin, it was found that average winter marsh temperatures greater then 8 degrees C reduced carbohydrate reserves in Typha latifolia to an extent sufficient to inhibit shoot growth in the spring (Adriano et al. 1980). Cattail population success has been correlated with nutrient fertility (Boyd 1971), water level and substrate temperature (Adriano et al. 1980).

The plant tissues can store relatively high concentrations of some metals. Typha appears to have an internal copper and nickel tolerance mechanism. It is not likely that there is an evolutionary selection for heavy metal tolerance, but rather it is inherent in the species (Taylor and Crowder 1984).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Phenology

More info on this topic.

Broadleaf cattail typically flowers from late spring and summer in the northern part of its range and from spring to early summer in the southern part of its range [58]. Broadleaf cattail ramets typically die after flowering [77]. When broadleaf cattail seeds collected from across the United States were grown in a common garden, plants from seed collected in northern populations flowered earlier than plants from seed from southern populations [147]. In the Midwest, cattails usually emerge by early April, flower from July to September, and senescence before late October. Seeds typically remain on the spikes through the winter and disperse in spring [6]. Broadleaf cattail growth begins in March and ends in July at Mitry Lake near Yuma, Arizona. Foliage begins to die in October, and plants are usually dry by December [145]. On Paynes Prairie Basin in Alachua County, Florida, broadleaf cattail flowered for about 3 weeks in May. Fruits were ripe in June and July; seeds dispersed from August to November. Plants began drying in June and were dormant from November to January [170].

Timing of broadleaf cattail reproductive development by state and region
State/region Flowering and/or fruiting dates
Baja California flowers June-July [230]
California flowers June-July [161]
Carolinas flowers May-July; fruits June-November [175]
Florida flowers May-June in panhandle [30]; flowers spring-summer throughout Florida [235]
Illinois flowers June-October [156]
Kansas flowers June-July [10]
Nevada flowers June-August [108]; flowers June-July in south-central Nevada [14]
New Mexico flowers May-July [142]
Texas flowers April-June [46]
West Virginia flowers August-September [201]
Atlantic Coast flowers April-July [51]
Blue Ridge Province flowers May-July [233]
Great Plains flowers late May-July [82]; flowers June and fruits July-September in northern Great Plains [122]
Intermountain West flowers July-August for broadleaf cattail and broadleaf cattail × narrow-leaved cattail [36]
New England flowers July 7-23 [187]
  • 10. Bare, Janet E. 1979. Wildflowers and weeds of Kansas. Lawrence, KS: The Regents Press of Kansas. 509 p. [3801]
  • 51. Duncan, Wilbur H.; Duncan, Marion B. 1987. The Smithsonian guide to seaside plants of the Gulf and Atlantic coasts from Louisiana to Massachusetts, exclusive of lower peninsular Florida. Washington, DC: Smithsonian Institution Press. 409 p. [12906]
  • 82. Great Plains Flora Association. 1986. Flora of the Great Plains. Lawrence, KS: University Press of Kansas. 1392 p. [1603]
  • 6. Apfelbaum, Steven I. 1985. Cattail (Typha spp.) management. Natural Areas Journal. 5(3): 9-17. [68427]
  • 30. Clewell, Andre F. 1985. Guide to the vascular plants of the Florida Panhandle. Tallahassee, FL: Florida State University Press. 605 p. [13124]
  • 36. Cronquist, Arthur; Holmgren, Arthur H.; Holmgren, Noel H.; Reveal, James L.; Holmgren, Patricia K. 1977. Intermountain flora: Vascular plants of the Intermountain West, U.S.A. Vol. 6: The Monocotyledons. New York: Columbia University Press. 584 p. [719]
  • 46. Diggs, George M., Jr.; Lipscomb, Barney L.; O'Kennon, Robert J. 1999. Illustrated flora of north-central Texas. Sida Botanical Miscellany, No. 16. Fort Worth, TX: Botanical Research Institute of Texas. 1626 p. [35698]
  • 77. Grace, James B.; Wetzel, Robert G. 1981. Habitat partitioning and competitive displacement in cattails (Typha): experimental field studies. The American Naturalist. 118(4): 463-474. [17674]
  • 142. Martin, William C.; Hutchins, Charles R. 1981. A flora of New Mexico. Volume 2. Germany: J. Cramer. 2589 p. [37176]
  • 145. McDonald, Charles C.; Hughes, Gilbert H. 1968. Studies of consumptive use of water by phreatophytes and hydrophytes near Yuma, Arizona. In: Water resources of lower Colorado River--Salton Sea area. Geological Survey Professional Paper 486-F. Washington, DC: U.S. Department of the Interior, Geological Survey: F1 to F24. [18347]
  • 147. McNaughton, S. J. 1966. Ecotype function in the Typha community-type. Ecological Monographs. 36(4): 297-325. [17676]
  • 161. Munz, Philip A.; Keck, David D. 1973. A California flora and supplement. Berkeley, CA: University of California Press. 1905 p. [6155]
  • 170. Patton, Janet Easterday; Judd, Walter S. 1988. A phenological study of 20 vascular plant species occurring on the Paynes Prairie Basin, Alachua County, Florida. Castanea. 53(2): 149-163. [15081]
  • 175. Radford, Albert E.; Ahles, Harry E.; Bell, C. Ritchie. 1968. Manual of the vascular flora of the Carolinas. Chapel Hill, NC: The University of North Carolina Press. 1183 p. [7606]
  • 187. Seymour, Frank Conkling. 1982. The flora of New England. 2nd ed. Phytologia Memoirs 5. Plainfield, NJ: Harold N. Moldenke and Alma L. Moldenke. 611 p. [7604]
  • 201. Strausbaugh, P. D.; Core, Earl L. 1977. Flora of West Virginia. 2nd ed. Morgantown, WV: Seneca Books, Inc. 1079 p. [23213]
  • 230. Wiggins, Ira L. 1980. Flora of Baja California. Stanford, CA: Stanford University Press. 1025 p. [21993]
  • 233. Wofford, B. Eugene. 1989. Guide to the vascular plants of the Blue Ridge. Athens, GA: The University of Georgia Press. 384 p. [12908]
  • 235. Wunderlin, Richard P. 1998. Guide to the vascular plants of Florida. Gainesville, FL: University Press of Florida. 806 p. [28655]
  • 14. Beatley, Janice C. 1976. Vascular plants of the Nevada Test Site and central-southern Nevada: ecologic and geographic distributions. [Washington, DC]: U.S. Energy Research and Development Administration, Division of Biomedical and Environmental Research. 308 p. Available from ERDA, Springfield, VA. TID-26881/DAS. [63152]
  • 58. Flora of North America Association. 2008. Flora of North America: The flora, [Online]. Flora of North America Association (Producer). Available: http://www.fna.org/FNA. [36990]
  • 108. Kartesz, John Thomas. 1988. A flora of Nevada. Reno, NV: University of Nevada. 1729 p. [In 2 volumes]. Dissertation. [42426]
  • 122. Larson, Gary E. 1993. Aquatic and wetland vascular plants of the Northern Great Plains. Gen. Tech. Rep. RM-238. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 681 p. Jamestown, ND: Northern Prairie Wildlife Research Center (Producer). Available: http://www.npwrc.usgs.gov/resource/plants/vascplnt/vascplnt.htm [2006, February 11]. [22534]
  • 156. Mohlenbrock, Robert H. 1986. [Revised edition]. Guide to the vascular flora of Illinois. Carbondale, IL: Southern Illinois University Press. 507 p. [17383]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flowering/Fruiting

Flowering late spring--summer in north, spring--early summer in south.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Flower/Fruit

Fl. Per.: June-August.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Typha latifolia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGATATCGGTACTCTATATTTCATCTTCGGTGCCATTGCTGGAGTGATGGGCACATGCTTCTCCGTACTGATTCGTATGGAATTAGCCCGACCCGGCGATCAAATTCTTGGTGGGAATCATCAACTTTATAATGTTTTAATAACGGCTCACGCTTCTTTAATGATCTTTTTTATGGTTATGCCGGCGATGATAGGTGGATCTGGTAATTGGTCTGTTCCGATTCTGATAGGTGCACCTGACATGGCATTTCCACGATCAAATAATATATCATTCTGGTTGTTGCCACCAAGTCTCTTGCTCCTATTAAGCCCAGCCTTAGTAGAAGTGGGTAGCGGCACTGGGTGGACGGTCTATCCGCCCTTAAGTGGTATTACCAGCCATTCTGGAGGAGCAGTTGATTCAGCAATTTCTAGTCCTCATCTATCAGGTGTTTCATCAATTTTAGGTTCTATTAATTTTATAACTACTATCTCCAACATGCGTGGACCTGGAATGACTATGCATAGATCACCCCTTTTTGTGTGGTCCGTTCTAGTGACAGCATTCCTACTTTTATTATCACTTCCGGTACTGGCAGGGGCAATTACAATGTTATTAACCGATCGAAACTTTAATACAACCTTTTCTGATCCTGCTGGAGGGGGAGACCCCATAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Typha latifolia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Information on state-level protected status of plants in the United States is available at Plants Database.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Wide distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Common and widespread (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Please consult the PLANTS Web site and your State Department of Natural Resources for this plant’s current status, such as, state noxious status and wetland indicator values.

Public Domain

USDA NRCS National Plant Data Center & Idaho Plant Materials Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Cattail management may be desired in situations where cattails have responded to wetland disturbance by growing in dense monocultures. The genus Typha can behave like aggressive introduced weeds in a variety of natural communities throughout North America (Apfelbaum 1985). Cattails are considered serious weeds in some countries (Holm et al. 1979, Morton 1975) but not necessarily in North America.

In high-quality natural communities, cattails usually occur as scattered sterile plants (Apfelbaum 1985). With disruptions to a community, cattail populations may respond by spreading vegetatively at a rapid rate. The effect of the growth spurt is closing open water, eliminating habitat and species diversity, and reducing the opportunity for other plants to become established and survive. Shading is a significant effect on other plants. Cattails are successful because they form extensive monocultures very rapidly through vegetative reproduction and maintain their dominance with the formation of dense rhizomes mats and litter.

Cattails have a wide ecological amplitude compared to other species (Pianka 1973). They are tolerant to habitat changes, pollutants in the water system, and saline or basic substrates. A study in Indiana concluded that the three basic events precede the growth of cattails monocultures: 1. modified surface hydrology, 2. wildfire suppression, and 3. wetland enrichment (Wilcox et al. 1984). Claims that hybrid cattails are responsible for monoculture growths have not been confirmed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Not threatened at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Management considerations

More info for the terms: density, marsh, ramet

Nonnative species interactions: Purple loosestrife (Lythrum salicaria) and reed mannagrass (Glyceria
maxima) are nonnative wetland species that may affect broadleaf cattail growth and
development. Several studies shown purple loosestrife can
alter site conditions and reduce broadleaf cattail germination and growth.
Additional information on purple loosestrife growth with broadleaf cattail or in
broadleaf cattail habitats is available from the following references: [57,85,127,223,224].
For a description of reed mannagrass invasions in broadleaf cattail-dominated
wetlands, see Wei and Chow-Fraser [222].
Broadleaf cattail and broadleaf cattail × narrow-leaved cattail invasions:
In some areas, broadleaf cattail has increased at the expense of other native species. In Harewood
Marsh of Jefferson County, West Virginia, hydrologic changes and increased
nutrient inputs may have facilitated broadleaf cattail increases, which may
threaten rare species' persistence [49]. Nutrient enrichment also likely
facilitated broadleaf cattail encroachment of sawgrass into the northern and central Everglades [35].
Urban runoff that increased nitrogen and phosphorus
inputs coincided with broadleaf cattail × narrow-leaved cattail increases in
Gardner Marsh in the University of Wisconsin-Madison Arboretum. Experiments
revealed that broadleaf cattail × narrow-leaved cattail aboveground
biomass, ramet density, and height were greater in fertilized than in control
plots [234].
Broadleaf cattail control:
Numerous studies and research address control of broadleaf cattail. Chemical control is
discussed in the following references: [141,157,164,197,213]. Physical,
mechanical, cultural, and biological control methods are available in these
sources: [16,69,128,141,164,197].
  • 128. Leininger, Wayne C. 1988. Non-chemical alternatives for managing selected plant species in the western United States. XCM-118. Fort Collins, CO: Colorado State University, Cooperative Extension. In cooperation with: U.S. Department of the Interior, Fish and Wildlife Service. 47 p. [13038]
  • 16. Beule, John D. 1979. Control and management of cattails in southeastern Wisconsin wetlands. Tech. Bull No. 112. Madison, WI: Department of Natural Resources. 40 p. [14574]
  • 57. Fickbohm, Scott S.; Zhu, Wei-Zing. 2006. Exotic purple loosestrife invasion of native cattail freshwater wetlands: effects on organic matter distribution and soil nitrogen cycling. Applied Soil Ecology. 32(1): 123-131. [68446]
  • 164. Nelson, Noland F.; Dietz, Reuben H. 1966. Cattail control methods in Utah. Publication No. 66-2. Salt Lake City, UT: Utah State Department of Fish and Game. 66 p. [17809]
  • 197. Steenis, John H.; Smith, Lawrence P.; Cofer, Henry P. 1959. Studies on cattail management in the Northeast. In: Transactions of the Northeast wildlife conference: Proceedings; 1958 June 4-7; Montreal, QC. Montreal, QC: University of Montreal, Department of Game and Fisheries: 149-155. [19975]
  • 224. Weihe, Paul Edward. 1993. The effects of environmental conditions on competition between purple loosestrife (Lythrum salicaria L.) and broad-leaved cattail (Typha latifolia L.). Ypsilanti, MI: Eastern Michigan University. 61 p. Thesis. [68576]
  • 234. Woo, Isa; Zedler, Joy B. 2002. Can nutrients alone shift a sedge meadow towards dominance by the invasive Typha x glauca? Wetlands. 22(3): 509-521. [68522]
  • 35. Craft, Christopher B.; Richardson, Curtis J. 1997. Relationships between soil nutrients and plant species composition in Everglades peatlands. Journal of Environmental Quality. 26(1): 224-232. [68440]
  • 49. Drohan, P. J.; Ross, C. N.; Anderson, J. T.; Fortney, R. F.; Rentch, J. S. 2006. Soil and hydrological drivers of Typha latifolia encroachment in a marl wetland. Wetlands Ecology and Management. 14(2): 107-122. [68442]
  • 69. Gillespie, JoAnn. 1990. Cutting suppresses cattail, encourages other species in Wisconsin wetland. Restoration and Management Notes. 8(1): 42-43. [14517]
  • 85. Hager, Heather A. 2004. Competitive effect versus competitive response of invasive and native wetland plant species. Oecologia. 139(1): 140-149. [48442]
  • 127. Lee, Chuen-Lian. 2001. The potential allelopathic influences of purple loosestrife Lythrum salicaria L. on native plants. Ypsilanti, MI: Eastern Michigan University. 116 p. Thesis. [68569]
  • 141. Martin, Alex C.; Erickson, Ray C.; Steenis, John H. 1957. Improving duck marshes by weed control. Circular 19 (Revised). Washington, DC: U.S. Department of the Interior, Bureau of Sport Fisheries and Wildlife. 60 p. [16324]
  • 157. Moore, M. T.; Huggett, D. B.; Huddleston, G. M., III; Rodgers, J. H., Jr.; Cooper, C. M. 1999. Herbicide effects on Typha latifolia (Linneaus) germination and root and shoot development. Chemosphere. 38(15): 3637-3647. [68549]
  • 213. Vallentine, John F. 1971. Range development and improvements. Provo, UT: Brigham Young University Press. 516 p. [2414]
  • 222. Wei, Anhua; Chow-Fraser, Patricia. 2006. Synergistic impact of water level fluctuation and invasion of Glyceria on Typha in a freshwater marsh of Lake Ontario. Aquatic Botany. 84(1): 63-69. [68518]
  • 223. Weihe, Paul E.; Neely, Robert K. 1997. The effects of shading on competition between purple loosestrife and broad-leaved cattail. Aquatic Botany. 59(1-2): 127-138. [68519]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation action is not needed for this common species. Plantlife has included the bulrush in its Common Plant Survey. This survey aims to determine the status of 65 common plant species in Britain, in order to understand how these species are faring in the countryside and to effectively monitor changes in their populations (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivars, improved and selected materials (and area of origin)

Local sources are recommended. This species should be available from any local nursery specializing in aquatic plants.

Public Domain

USDA NRCS National Plant Data Center & Idaho Plant Materials Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Heavy grazing will eliminate Typha species as well as other native species from riparian corridors. However, cattails are fairly resistant to moderate grazing, providing wet soils are not compacted.

Because cattails have relatively little value for ducks, they are often regarded as undesirable weeds in places intended primarily for ducks. It has been found that mowing cattails after the heads are well formed but not mature and then following up with another mowing about a month later, when new growth is two or three feet high, will kill at least 75% of the plants. This will enable other emergent vegetation with more palatable and nutritious seeds to become established.

Ecologically, cattails tend to invade native plant communities when hydrology, salinity, or fertility changes. In this case they out compete native species, often becoming monotypic stands of dense cattails. Maintaining water flows into the wetland, reducing nutrient input and maintaining salinity in tidal marshes will help maintain desirable species composition. If cattails begin to invade, physical removal may be necessary.

Public Domain

USDA NRCS National Plant Data Center & Idaho Plant Materials Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Other uses and values

Native Americans and early European settlers utilized broadleaf cattail as a food source, a construction material, and a medicine. Broadleaf cattail has numerous uses and has been referred to as the "supermarket of the swamps" [185]. Liptay [133] indicated that tribal wars were waged over control of broadleaf cattail marshes.

Food source: Broadleaf cattail is entirely edible, and Native Americans utilized broadleaf cattail year-round. Newly emerged sprouts were eaten as a green vegetable in the spring. Flower stalks were boiled and eaten like corn on the cob. Broadleaf cattail pollen, which has a nutty flavor and is high in protein, was added to other flours. Rhizomes were dug and eaten in the fall and winter. They were cooked or dried, pounded, and used in flour [1,10,133]. Comparisons of the nutrient values of broadleaf cattail, rice, and potatoes revealed that broadleaf cattail shoots and rhizomes contained much more calcium, iron, and potassium than potatoes or rice [133]. Broadleaf cattail was utilized as a food source by the Kawaiisu of south-central California [239], the Cahuilla of southern California [13], the Apache and other southwestern Natives [26], Native people along the Atlantic Coast [51], the Menominee of northern Wisconsin, the Ojibwe in Michigan [185], and likely many others.

Construction/ornamental/ceremonial material: Broadleaf cattail had a tremendous number of household and ceremonial uses. Leaves were used to make mats, dolls, baskets, and shelters. The hairs of fruits were used as sound-proofing material, insulation, pillow and lifejacket stuffing, and as tinder for fire starting. A paste made from rhizomes was used to caulk leaky canoes [10,133]. Early European settlers used the hollow broadleaf cattail stems to make candles [50]. Native people of the Pacific Northwest wove leaves into bedding, kneeling mats, capes, hats, blankets, and bags. Seed fluff was used to dress wounds and to stuff pillows, mattresses, and diapers [172]. Fluff material from seeds was used by the Menominee of northern Wisconsin and the Ojibwe of Michigan to insulate boots and jackets [185]. The same material was used by tribes of the Missouri River region as diaper material, pillow filling, and cradle board padding. Broadleaf cattail stem pieces were used as ceremonial objects by the Omaha and Ponca people [70]. Natives of southern California used broadleaf cattail leaves to construct houses as well as bedding [13,239]. Navaho people wore bracelets and necklaces made of broadleaf cattail leaves during the Male Shooting Chant ceremony, and dancers were dusted with broadleaf cattail pollen in other ceremonies [53]. The northern Cheyenne of Montana incorporated broadleaf cattail leaves into their Sun Dance [95].

Medicinal use: Broadleaf cattail was most commonly used as a wound dressing. Rhizomes were ground into a salve for wounds [133]. The Cahuilla of southern California used broadleaf cattail rhizomes to stop bleeding [13]. The northern Cheyenne of Montana made a tea of roots and leaf bases to treat stomach cramps [95]. The Sioux mixed "downy" cattail fruits with coyote fat to treat smallpox sores [94]. Tribes of the Missouri River region used fluff from broadleaf cattail seeds to make burn dressings [70]. For more on the past, current, and potential future uses of broadleaf cattail and other cattail species, see Morton [158].

  • 10. Bare, Janet E. 1979. Wildflowers and weeds of Kansas. Lawrence, KS: The Regents Press of Kansas. 509 p. [3801]
  • 51. Duncan, Wilbur H.; Duncan, Marion B. 1987. The Smithsonian guide to seaside plants of the Gulf and Atlantic coasts from Louisiana to Massachusetts, exclusive of lower peninsular Florida. Washington, DC: Smithsonian Institution Press. 409 p. [12906]
  • 172. Pojar, Jim; MacKinnon, Andy, eds. 1994. Plants of the Pacific Northwest coast: Washington, Oregon, British Columbia and Alaska. Redmond, WA: Lone Pine Publishing. 526 p. [25159]
  • 13. Bean, Lowell John; Saubel, Katherine Siva. 1972. Telmalpakh: Chauilla Indian knowledge and usage of plants. Banning, CA: Malki Museum. 225 p. [35898]
  • 26. Castetter, Edward F.; Opler, M. E. 1936. Ethnobiological studies in the American Southwest. III. The ethnobiology of the Chiricahua and Mescalero Apache. University of New Mexico Bulletin. 4(5): 1-63. [38173]
  • 50. Duke, James A. 1992. Handbook of edible weeds. Boca Raton, FL: CRC Press. 246 p. [52780]
  • 53. Elmore, Francis H. 1944. Ethnobotany of the Navajo. Monograph Series: 1(7). Albuquerque, NM: University of New Mexico. 136 p. [35897]
  • 70. Gilmore, Melvin Randolph. 1919. Uses of plants by the Indians of the Missouri River region. In: 33rd annual report of the Bureau of American Ethnology. Washington, DC: Bureau of American Ethnology: 44-154. [6928]
  • 94. Hart, J. 1976. Montana native plants and early peoples. Helena, MT: Montana Historical Society. 75 p. [9979]
  • 95. Hart, Jeffrey A. 1981. The ethnobotany of the Northern Cheyenne Indians of Montana. Journal of Ethnopharmacology. 4: 1-55. [35893]
  • 133. Liptay, Albert. 1989. Typha: review of historical use and growth and nutrition. Acta Horticulturae. 242: 231-238. [68463]
  • 158. Morton, Julia F. 1975. Cattails (Typha spp.) - Weed problem or potential crop? Economic Botany. 29: 7-29. [17675]
  • 185. Schmidt, Judith G. 1990. Ethnobotany of contemporary Northeastern "Woodland" Indians: its sharing with the public through photography. Advances in Economic Botany. 8: 224-240. [49683]
  • 239. Zigmond, Maurice L. 1981. Kawaiisu ethnobotany. Salt Lake City, UT: University of Utah Press. 102 p. [35936]
  • 1. Alderman, DeForest C.; Craigmill, Arthur L. 1981. [Revised]. Native edible fruits, nuts, vegetables, herbs, spices, and grasses of California: III. Vegetables. Leaflet 2705. Berkeley, CA: University of California, Division of Agricultural Sciences, Cooperative Extension. 18 p. [67653]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Value for rehabilitation of disturbed sites

More info for the terms: reclamation, succession

Broadleaf cattail's high wildlife value, potential for erosion control, and tolerance of heavy metals makes it desirable in reclamation or revegetation efforts [176]. Studies found broadleaf cattail grew on "industrially degraded habitats" with heavy metals and high acidity in western Pennsylvania and in Ontario [150]. Broadleaf cattail also dominated slime ponds 3 years after phosphate mining was discontinued on Florida's central peninsula [17].

In western Montana, laboratory and field experiments revealed that broadleaf cattail aerated soils and may have facilitated neighboring plant growth [25]. Planting broadleaf cattail on degraded sites may not be necessary, since this species rapidly colonizes disturbed sites through seed dispersal or germination from a persistent seed bank. See Seed banking, Seed dispersal, and Secondary succession for details.

  • 17. Blue, W. G.; Mislevy, P. 1981. Reclamation of quartz-sand tailings and slime ponds from phosphate mining in Florida. In: Land-use allocation: processes, people, politics, professionals: Proceedings of the 1980 convention of the Society of American Foresters; 1980 October 6-8; Spokane, WA. Washington, DC: The Society of American Foresters: 227-234. [9956]
  • 25. Callaway, Ragan M.; King, Leah. 1996. Temperature-driven variation in substrate oxygenation and the balance of competition and facilitation. Ecology. 77(4): 1189-1195. [55980]
  • 150. McNaughton, S. J.; Folsom, T. C.; Lee, T.; Park, F.; Price, C.; Roeder, D.; Schmitz, J.; Stockwell, C. 1974. Heavy metal tolerance in Typha latifolia without the evolution of tolerant races. Ecology. 55(5): 1163-1165. [17559]
  • 176. Rainier Seeds, Inc. 2003. Catalog, [Online]. Davenport, WA: Rainer Seeds, Inc., (Producer). Available: http://www.rainerseeds.com [2003, February 14]. [27624]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance to Livestock and Wildlife

More info for the terms: cover, fen, frequency, marsh, natural, phase, rhizome

Broadleaf cattail may comprise a small portion of livestock and native ungulate diets during dry conditions and/or when other more palatable upland forage is unavailable [18,152]. For waterfowl, other marsh birds, and small mammals, broadleaf cattail provides food and important nesting, brooding, and loafing habitat [10,118,154,172,203]. Broadleaf cattail is extremely important to common muskrats. It provides a major food source and important nesting habitats and materials [37,62].

Livestock: In northwestern Montana, broadleaf cattail habitat types may receive heavy livestock use if water levels are low and/or upland forage is limited [18]. In wetlands of southeastern Alberta, heavy cattle grazing and trampling did not affect mature established stands [111].

Native ungulates: Deer and elk use of broadleaf cattail is noted in Montana and Washington. Deer may use broadleaf cattail stands for food and shade or hiding cover in northwestern Montana [18]. Elk feces from the Mount St Helens blast zone in southwestern Washington had an average broadleaf cattail content of 0.1% to 1.3% from June to September [152].

Small mammals: Broadleaf cattail provides nest habitat and food for a variety of small mammals. In the Great Plains, broadleaf cattail is used as a lining in small mammal nests [203]. Grass-cattail habitats of No Name Lake along the lower Colorado River in Arizona had the highest capture rate per unit effort for Arizona cotton rats. Direct use of broadleaf cattail by the Arizona cotton rat was not discussed [3]. A study of gray catbird nesting concentrated in Michigan revealed that white-footed mice took over and modified these nests for their own. Cattail down was found in some of these nests and apparently brought in by white-footed mice [166].

In North Carolina, South Carolina, Louisiana, and Texas, broadleaf cattail was an important nutria food source. In marshes of North Carolina's Hatteras Island, broadleaf cattail was a primary summer food for nutria. Broadleaf cattail was consumed less in the winter [154]. A review cited several sources that identified broadleaf cattail or other cattails as important foods for nutria in Texas, Louisiana, and South Carolina [112].

Common muskrats: Broadleaf cattail is a primary common muskrat food, and broadleaf cattail habitats are used extensively for nesting. In the prairie pothole region of the north-central United States and south-central Canada, cattails are considered a "staple" common muskrat food [62]. In marshlands south of Saskatoon, Saskatchewan, broadleaf cattail was preferred winter habitat based on availability and use (P<0.05) [153]. Cattail stems are combined with mud to construct lodges. When common muskrats populations are high, cattail can decrease with extensive use [37]. In the Corinna marsh area of central Maine, broadleaf cattail was an important year-round common muskrat food. Broadleaf cattail frequency on feeding platforms averaged 45% overall and 85% and 87% in fall and winter, respectively [205]. Broadleaf cattail occurred in 78.9% of common muskrat feed beds in an alkaline fen on Upper Chateaugay Lake in New York [117]. After heavy common muskrat feeding on broadleaf cattail in a wetland north of Cambridge, Maryland, broadleaf cattail vegetation was converted to a green arrow arum-dominated type. The solid broadleaf cattail rhizome mat changed to an unconsolidated, anoxic, organic substrate, and the marsh was lowered by 2 to 6 inches (5-15 cm) [66]. In Gulf Coast marshes of southern Louisiana and Texas, common muskrats feed on broadleaf cattail primarily when Olney threesquare is unavailable [136].

Birds: Waterfowl and other marsh birds throughout the United States and Canada use broadleaf cattail habitats extensively. Specific studies and research are organized geographically in the paragraphs below.

Western habitats: Red-necked grebes, whooping cranes, marsh wrens, blackbirds, sandhill cranes, rails, and ring-necked pheasants all utilize broadleaf cattail habitats. Researchers located 89 red-necked grebe nests in natural and man-made ponds in Yellowknife, Northwestern Territories. Broadleaf cattail was used as a construction material in 43% of nests, and 39% of nest were anchored to broadleaf cattail [60]. In Wood Buffalo National Park in western Canada, whooping cranes used softstem bulrush-broadleaf cattail communities as nesting habitat [207]. Wrens, blackbirds, and waterfowl utilized broadleaf cattail as habitat and food in the Pacific Northwest [172]. In Oregon's Malheur National Wildlife Refuge, sandhill crane nests were better concealed and had higher success rates in hardstem bulrush and broadleaf cattail than in broadfruit bur-reed (Sparganium eurycarpum) or meadows. Nest rate success in broadleaf cattail vegetation was 58.8% [134]. Broadleaf cattail/hardstem bulrush marshes along the Colorado River between the Arizona/Nevada and US/Mexico borders were utilized by insectivorous and granivorous wading, water, and shorebirds [4]. In northwestern Montana, the broadleaf cattail habitat type is critical nesting and roosting habitat for red-winged and yellow-headed blackbirds [18]. Hen ring-necked pheasants on the Snake River Plain in southern Idaho used wetlands dominated by broadleaf cattail or willow for loafing, day escape, roosting, and thermal night winter cover more than expected based on availability (P<0.01) [129]. In Colorado, broadleaf cattail habitats were important nesting cover and habitat for soras, Virginia rails, blackbirds, and marsh wrens [83,221].

Central/eastern habitats: Canada geese, snow geese, mallards, sandhill cranes, marsh wrens, and blackbirds utilize broadleaf cattail habitats throughout central and eastern US and Canada habitats. In Marshy Point, Manitoba, Canada geese preferred broadleaf cattail to hardstem bulrush vegetation for nesting. Preferred nesting habitats were determined from nest occurrence and availability of the vegetation type. Over a 3-year period, 133 nests were found in broadleaf cattail. Nest predation was greater in bulrush, 24%, than in broadleaf cattail, 9% [34]. In the Delta Marsh of south-central Manitoba, breaking up continuous broadleaf cattail stands and increasing open water increased habitat use by nesting mallards. Use and production of dabbling ducks was maximized in the hemimarsh phase of development, when cover of water and emergent vegetation were nearly equal [162]. Sandhill crane nests were found in a wetland in Kennebec County, Maine. Nests were surrounded by broadleaf cattail and were constructed entirely of the previous season's broadleaf cattail stems and leaves [151]. In Kansas, broadleaf cattail vegetation is shelter and nest cover for red-winged blackbirds, yellow-headed blackbirds, and marsh wrens [10]. In Gulf Coast marshes of Louisiana and Texas, snow geese feed on broadleaf cattail roots and rhizomes in the winter when tides are low and Olney threesquare is unavailable. In a cold winter, snow geese "devoured several square miles of cattail marsh" [136].

Palatability/nutritional value: Nutritional value of broadleaf cattail was reported for southwestern Washington, northern Texas, and northern New York. Dry matter digestibility of vegetative broadleaf cattail collected in the summer from the Mount St Helens blast zone was 52%. Digestibility was 59.2% when plants were in flower. Vegetative plants were 2.95% nitrogen, and nitrogen was 2.93% in flowering plants [152]. The nutritive quality of broadleaf cattail was evaluated in the spring from control, grazed, and spring burned wetlands in Castro County, Texas. Differences between treatments were rarely significant. Broadleaf cattail protein ranged from 9.8% to 15%, ash was 10.3% to 13.4%, cellulose was 25.9% to 32.9%, and lignin was 13.4% to 19.5% [192]. Lacki and others [117] provide nutrient content and digestibility of broadleaf cattail collected in summer on the Upper Chateaugay Lake, New York.

Cover value: Broadleaf cattail stands are important cover for waterfowl, songbirds, and other wildlife species throughout its range [10,18,99,203]. Species specific information is available in Importance to Livestock and Wildlife.

  • 10. Bare, Janet E. 1979. Wildflowers and weeds of Kansas. Lawrence, KS: The Regents Press of Kansas. 509 p. [3801]
  • 18. Boggs, Keith; Hansen, Paul; Pfister, Robert; Joy, John. 1990. Classification and management of riparian and wetland sites in northwestern Montana. Draft Version 1. Missoula, MT: University of Montana, School of Forestry, Montana Forest and Conservation Experiment Station, Montana Riparian Association. 217 p. [8447]
  • 37. Curtis, John T. 1959. Aquatic communities. In: Curtis, John T. The vegetation of Wisconsin. Madison, WI: The University of Wisconsin Press: 385-401. [60531]
  • 60. Fournier, Michael A.; Hines, James E. 1998. Breeding ecology and status of the red-necked grebe, Podiceps grisegena, in the subarctic of the Northwest Territories. The Canadian Field-Naturalist. 112(3): 474-480. [68448]
  • 66. Garbisch, Edgar. 1994. The results of muskrat feeding on cattails in a tidal freshwater wetland. Wetland Journal. 6(1): 14-15. [22800]
  • 99. Hitchcock, C. Leo; Cronquist, Arthur. 1973. Flora of the Pacific Northwest. Seattle, WA: University of Washington Press. 730 p. [1168]
  • 111. Keith, Lloyd B. 1961. A study of waterfowl ecology on small impoundments in southeastern Alberta. Wildlife Monographs. 6: 1-88. [4501]
  • 136. Lynch, John J.; O'Neil, Ted; Lay, Daniel W. 1947. Management significance of damage by geese and muskrats to Gulf Coast marshes. Journal of Wildlife Management. 11(1): 50-76. [14559]
  • 172. Pojar, Jim; MacKinnon, Andy, eds. 1994. Plants of the Pacific Northwest coast: Washington, Oregon, British Columbia and Alaska. Redmond, WA: Lone Pine Publishing. 526 p. [25159]
  • 3. Andersen, Douglas C.; Nelson, S. Mark. 1999. Rodent use of anthropogenic and 'natural' desert riparian habitat, lower Colorado River, Arizona. Regulated Rivers: Research and Management. 15(5): 377-393. [35902]
  • 4. Anderson, Bertin W.; Ohmart, Robert D.; Meents, Julie K.; Hunter, William C. 1984. Avian use of marshes on the lower Colorado River. In: Warner, Richard E.; Hendrix, Kathleen M., eds. California riparian systems: Ecology, conservation, and productive management: Proceedings; 1981 September 17-19; Davis, CA. Berkeley, CA: University of California Press: 598-604. [5861]
  • 34. Cooper, James A. 1978. The history and breeding biology of the Canada geese of Marshy Point, Manitoba. Wildlife Monographs No. 61. Washington, DC: The Wildlife Society. 87 p. [18122]
  • 62. Fritzell, Erik K. 1989. Mammals in prairie wetlands. In: Vander Valk, Arnold, ed. Northern prairie wetlands. Ames, IA: Iowa State University Press: 268-301. [15219]
  • 83. Griese, Herman J. 1977. State and habitat utilization of rails in Colorado. Fort Collins, CO: Colorado State University. 65 p. Thesis. [60916]
  • 112. Kinler, Noel W.; Linscombe, Greg; Ramsey, Paul R. 1987. Nutria. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 326-342. [50675]
  • 117. Lacki, Michael J.; Peneston, William T.; Adams, Kenneth B.; Vogt, F. Daniel; Houppert, Joseph C. 1990. Summer foraging patterns and diet selection of muskrats inhabiting a fen wetland. Canadian Journal of Zoology. 68(6): 1163-1167. [68461]
  • 118. Lackschewitz, Klaus. 1991. Vascular plants of west-central Montana--identification guidebook. Gen. Tech. Rep. INT-227. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 648 p. [13798]
  • 129. Leptich, David J. 1992. Winter habitat use by hen pheasants in southern Idaho. Journal of Wildlife Management. 56(2): 376-380. [18317]
  • 134. Littlefield, Carroll D. 1995. Sandhill crane nesting habitat, egg predators, and predator history on Malheur National Wildlife Refuge, Oregon. Northwestern Naturalist. 76(3): 137-143. [68464]
  • 151. Melvin, Scott M. 2002. First breeding records and historical status of sandhill cranes in Maine and New England. Northeastern Naturalist. 9(2): 193-202. [68548]
  • 152. Merrill, Evelyn H.; Callahan-Olson, Angela; Raedeke, Kenneth J.; Taber, Richard D.; Anderson, Robert J. 1995. Elk (Cervus elaphus roosevelti) dietary composition and quality in the Mount St. Helens blast zone. Northwest Science. 69(1): 9-18. [26633]
  • 153. Messier, F.; Virgl, J. A.; Marinelli, L. 1990. Density-dependent habitat selection in muskrats: a test of the ideal free distribution model. Oecologia. 84(3): 380-385. [17425]
  • 154. Milne, Robert C.; Quay, Thomas L. 1967. The foods and feeding habits of the nutria on Hatteras Island, North Carolina. Proceedings, Annual Conference of Southeastern Association of Game and Fish Commissions. 20: 112-123. [15302]
  • 162. Murkin, Henry R.; Kaminski, Richard M.; Titman, Rodger D. 1982. Responses by dabbling ducks and aquatic invertebrates to an experimentally manipulated cattail marsh. Canadian Journal of Zoology. 60: 2324-2332. [17669]
  • 166. Nickell, Walter P. 1965. Habitats, territory, and nesting of the catbird. The American Midland Naturalist. 73(2): 433-478. [23360]
  • 192. Smith, Loren M. 1989. Effects of grazing and burning on nutritive quality of cattail in Playas. Journal of Aquatic Plant Management. 27: 51-53. [11149]
  • 203. Stubbendieck, James; Coffin, Mitchell J.; Landholt, L. M. 2003. Weeds of the Great Plains. 3rd ed. Lincoln, NE: Nebraska Department of Agriculture, Bureau of Plant Industry. 605 p. In cooperation with: University of Nebraska, Lincoln. [50776]
  • 205. Takos, Michael J. 1947. A semi-quantitative study of muskrat food habits. Journal of Wildlife Management. 11(4): 331-339. [67566]
  • 207. Timoney, Kevin. 1999. The habitat of nesting whooping cranes. Biological Conservation. 89: 189-197. [53513]
  • 221. Weber, William A. 1987. Colorado flora: western slope. Boulder, CO: Colorado Associated University Press. 530 p. [7706]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cultivation

The preference is full sun, wet conditions, and soil that is muddy or sandy. This plant is an emergent aquatic that can tolerate standing water up to 1½' deep. It can tolerate drought if the soil remains moist. In more shady areas, fewer spikes of flowers are produced and individual plants may die out. In suitable habitat, Common Cattail spreads aggressively.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© John Hilty

Source: Illinois Wildflowers

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Uses

Ethnobotanic: All parts of the cattail are edible when gathered at the appropriate stage of growth. The young shoots are cut from the rhizomes (underground stems) in the spring when they are about 4 to 16 inches long. The raw young shoots taste like cucumber and can also be made into pickles. When the young shoots are steamed they taste like cabbage. The base of the stem where it attaches to the rhizome can be boiled or roasted like potatoes. The young flower stalks can be taken out of their sheaths and can be boiled or steamed just like corn (Roos-Collins 1990; Clarke 1977).

Cattail pollen is a fine substitute for flours. It is a bright yellow or green color, and turns pancakes, cookies or biscuits a pretty yellow color (which children love). The rhizomes (underground stems) and lower stems have a sweet flavor and can be eaten raw, baked, roasted, or broiled. Cattail rhizomes are fairly high in starch content; this is usually listed at about 30% to 46%. The core can be ground into flour. One acre of cattails would yield about 6,475 pounds of flour (Harrington 1972). This flour would probably contain about 80 % carbohydrates and around 6% to 8% protein. Since cattail occurs around the world, it is a potential source of food for the worlds' population.

Newly emerging shoots of cattails are edible, with delicate flavor and crispy asparagus like texture (Glenn Keator, Linda Yamane, Ann Lewis 1995). The end of a new stem of cattail is popular for eating with Washoes (Murphy 1959). When mixed with tallow, the brown fuzz can be chewed like gum.

The Klamath and Modocs of northern California and southern Oregon make flexible baskets of twined tule or cattail. Cattails or tules were also twined to form mats of varying sizes for sleeping, sitting, working, entertaining, covering doorways, for shade, and a myriad of other uses.

The Cahuilla Indians used the stalks for matting, bedding material, and ceremonial bundles (Barrows 1967). Some tribes used the leaves and sheath bases as caulking materials. Apaches used the pollen in female puberty ceremonies. After dipping the spike in coal oil, the stalk makes a fine torch. The fluff can also be used as tinder, insulation, or for lining baby cradleboards. The down is used for baby beds (Murphey 1959).

Lengths of cattail were plied into rope or other size cordage, and cattail rope was used in some areas to bind bundles of tule into tule boats. Air pockets or aerenchyma in the stems provide the buoyancy that makes tule good boat-building material.

Other Uses: Wildlife, wetland restoration, wastewater tertiary treatment, edible (young shoots, base of stem, flower stalks, pollen, rhizomes), and aesthetics. The multitudes of tiny, wind-carried seeds are too small and too hairy to be attractive to birds (Hotchkiss and Dozier 1949). In a few exceptions, the seeds are eaten by several duck species. Cattail rootstocks are much more valuable as food for wildlife than are the seeds. Geese and muskrats prefer the stems and roots. Moose and elk eat fresh spring shoots. Shelter and nesting cover are provided for long-billed marsh wrens, red-wing blackbirds, and yellow-headed blackbirds.

Public Domain

USDA NRCS National Plant Data Center & Idaho Plant Materials Center

Source: USDA NRCS PLANTS Database

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Typha latifolia

Typha latifolia (Bulrush, Common Bulrush, Broadleaf Cattail, Common Cattail, Great Reedmace, Cooper's reed, Cumbungi) is a perennial herbaceous plant in the genus Typha. It is found as a native plant species in North and South America, Europe, Eurasia, and Africa.[1] In Canada, broadleaf cattail occurs in all provinces and the Northwest Territories, and in the United States, it is native to all states except Hawaii.[2] It is an introduced and invasive species, and considered a noxious weed, in Australia and Hawaii.[3] It is not native but has been reported in Indonesia, Malaysia, New Zealand, Papua New Guinea, and the Philippines.[1]

T. latifolia has been found in a variety of climates, including tropical, subtropical, southern and northern temperate, humid coastal, and dry continental.[2] It is found at elevations from sea level to 7,500 feet (2,300 m).

T. latifolia is an "obligate wetland" species, meaning that it is always found in or near water.[4] The species generally grows in flooded areas where the water depth does not exceed 2.6 feet (0.8 meters).[5] However, it has also been reported growing in floating mats in slightly deeper water.[2] T. latifolia grows mostly in fresh water but also occurs in slightly brackish marshes.[4] The species can displace other species native to salt marshes upon reduction in salinity. Under such conditions the plant may be considered invasive, since it interferes with preservation of the salt marsh habitat.[4]

T. latifolia shares its range with other related species, and hybridizes with Typha angustifolia, narrow-leaf cattail, to form Typha × glauca (Typha angustifolia × T. latifolia), white cattail.[2] Common cattail is usually found in shallower water than narrow-leaf cattail.

The plant is 1.5 to 3 metres (5 to 10 feet) high and it has 2-4cm (¾ to 1½ inch) broad leaves, and will generally grow out in to 0.75 to 1 metre (2 to 3 feet) of water depth.

Typha latifolia

T. latifolia is called totora, espadaña común, tule espidilla, or piriope in Spanish; roseau des étangs in French; tifa or mazzasorda in Italian, and tabua-larga in Portuguese.[1]

Uses[edit]

Traditionally, Typha latifolia has been a part of many native North American cultures, as a source of food, medicine, and for other uses. The rhizomes are edible after cooking and removing the skin, while peeled stems and leaf bases can be eaten raw, or cooked. Young flower spikes are edible as well.[6] Some cultures make use of the roots of T. latifolia as a poultice for boils, burns, or wounds.[citation needed] The Hopi Kachinas give the plant to children with toys attached, such as bows and dolls during the Home Dance.[citation needed]

While Typha latifolia grows all over, including in rural areas, it is not advisable to eat specimens deriving from polluted water as it is used as a bioremediator, it absorbs pollutants. Do not eat them if they taste very bitter or spicy.[7]

References[edit]

  1. ^ a b c "Typha latifolia (aquatic plant)", Global Invasive Species Database. Retrieved 2011-02-21.
  2. ^ a b c d "Typha latifolia, U.S. Forest Service Fire Effects Information Database", U.S. Forest Service. Retrieved 2011-02-20
  3. ^ "Typha latifolia (Typhaceae) Species description or overview", Hawaiian Ecosystems at Risk project (HEAR). Retrieved 2011-02-21.
  4. ^ a b c "USDA Plant Guide: Typha latifolia", United States Department of Agriculture. Retrieved 2011-02-20.
  5. ^ "Broadleaf Cattail", Utah State University Cooperative Extension. Retrieved 2011-02-20.
  6. ^ Turner, Nancy J. Food Plants of Interior First Peoples (Victoria: UBC Press, 1997) ISBN 0-7748-0606-0
  7. ^ YouTube - Wild Living with Sunny: episode 4 Video describing collection and cooking of common cattail.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Notes

Comments

The erect shoots of Typha latifolia are more fanlike when young than in other North American species because the proximal leaves (dying by mid season) spread more widely. Undoubtedly native throughout its North American range, where it is often a codominant or minor component of marshes, wet meadows, fens, and other communities. In many places it is apparently being replaced by T. angustifolia and T. angustifoliaT. latifolia (T. glauca) at least partly due to human disturbance of habitats. There is a specimen of T. xglauca from Anticosti Island, Quebec. Locally in California and perhaps elsewhere where hybrids are common, the pollen grains of some T. latifolia plants separate slightly and may be shed partly as mixtures of triads, dyads, and monads, perhaps due to introgression ([S. G. Smith, unpublisheddeletion.). Ph.D. thesis]. See also hybrids in key and genus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Missouri Botanical Garden, 4344 Shaw Boulevard, St. Louis, MO, 63110 USA

Source: Missouri Botanical Garden

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!