Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Baileya australis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATCAATAATTGGAGATGATCAGATTTATAATACAATTGTTACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGTTTCTGATTATTACCCCCTTCATTAACTTTATTAATTTCTAGAAGAATTGTAGAAAACGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCAAATATTGCTCATGGAGGAAGATCAGTAGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTAGGTATTACAGCATTTTTATTATTACTATCTCTTCCCGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGTAACTTAAATACATCATTTTTTGATCCAGCTGGAGGAGGGGATCCTATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Baileya australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Baileya nr. australis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Baileya australis

Baileya australis, the Small Baileya Moth, is a species of moth of the Nolidae family. It is found in North America, where it has been recorded from Quebec and New York to Florida, west to Texas, north to North Dakota and Ontario.[2]

The wingspan is 21-28 mm. The forewings are shiny grey, with silvery or whitish shading in the median area. The subterminal line is heavy and almost straight near the costa and the basal patch is white. The reniform spot is obscure and the postmedial line is sinuate. Adults are on wing from April to September in up to three generations per year in the south.[3]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!