Molecular Biology and Genetics

Molecular Biology

Barcode data: Craniophora ligustri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTCTAATACTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTATTACCACCTTCTTTAACCCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATGGTGGTAGATCAGTAGATTTAGCCATTTTTTCCCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGACTTAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGGTGTGGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTGTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACATCCTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Craniophora ligustri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Craniophora ligustri

The Coronet (Craniophora ligustri) is a moth of the family Noctuidae. It is found in Europe, through the Palearctic to Japan.

Caterpillar
Mounted adult

Distribution[edit]

Western Europe to Central Europe to the Russian Far East, northern China, Japan, Korea. In the North, the range extends to southern Scandinavia, the Baltic States and Central Russia (approximately St. North to St. Petersburg) as well as the Ukraine. However, on the Iberian Peninsula, the species is limited to the North. In the Eastern Mediterranean, it reaches Northern Greece with smaller isolated occurrence in Central Greece and the Peloponnese. The distribution area also includes Israel, Asia minor and the Caucasus. It occurs in Cyprus.

Description[edit]

See glossary for terms used

The wingspan is 30–35 mm.Forewing purplish fuscous, more or less greenish-tinged, with a paler patch beyond the cell ; prothorax conspicuously whitish. — ab. sundevalli Lampa is a form in which both forewing and thorax are entirely dark olivegreen.- ab. nigra Tutt has the forewing black throughout, without any green tinge, and has only been taken in the North of England; lastly, in ab. coronula Haw. the white apex is suffused with grey brown instead of green, with a white lunule on its inner edge.[1] The white patch diastal to the reniform appears to resemble a crown,hence the name Coronet.

Biology[edit]

The moth flies from April to September depending on the location.

The caterpillars feed on Fraxinus excelsior, Common Lilac and Ligustrum vulgare.[2]

References[edit]

  1. ^ Seitz, A. Ed., 1914 Die Großschmetterlinge der Erde, Verlag Alfred Kernen, Stuttgart Band 3: Abt. 1, Die Großschmetterlinge des palaearktischen Faunengebietes, Die palaearktischen eulenartigen Nachtfalter, 1914
  2. ^ "Robinson, G. S., P. R. Ackery, I. J. Kitching, G. W. Beccaloni & L. M. Hernández, 2010. HOSTS - A Database of the World's Lepidopteran Hostplants. Natural History Museum, London.". 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!