Molecular Biology and Genetics

Molecular Biology

Barcode data: Craniophora ligustri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTACCTCTAATACTAGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGATTATTACCACCTTCTTTAACCCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCTCATGGTGGTAGATCAGTAGATTTAGCCATTTTTTCCCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGACTTAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGGTGTGGGAATTACAGCATTTTTATTATTATTATCTTTACCTGTGTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACATCCTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Craniophora ligustri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Craniophora ligustri

The Coronet (Craniophora ligustri) is a moth of the family Noctuidae. It is found in Europe, through Northern Asia to Japan.

Caterpillar
Mounted adult

The wingspan is 30–35 mm. The moth flies from April to September depending on the location.

The caterpillars feed on Fraxinus excelsior, Common Lilac and Ligustrum vulgare.[1]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!