Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Cryphia algae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 30
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Cryphia algae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCCATTATAATTGGAGGATTTGGTAATTGACTTGTACCTTTAATACTAGGAGCCCCAGATATAGCATTCCCCCGAATAAATAATATAAGTTTTTGACTTCTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCACTTTCATCTAATATTGCCCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCACCTAGCGGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGATTAAATAGCTTATCTTTCGACCAAATACCTTTATTTGTATGAGCTGTAGGAATTACCGCATTCTTATTATTACTATCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCTTTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cryphia algae

The Tree-lichen Beauty (Cryphia algae) is a moth of the family Noctuidae. It is found in Mediterranean parts of Europe and the Near East.

The wingspan is 24–30 mm. The length of the forewings is 10–13 mm. The moth flies from July to September depending on the location.

The larvae feed on various Lichen species.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!