Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Apamea sordens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGGATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTAATAATTCGAGCCGAATTAGGAAATCCCGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTGTATCCCCCACTTTCATCCAACATTGCCCATGGAGGAAGTTCCGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATCTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACCGCATTTTTATTATTACTATCTCTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATCTGAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Apamea sordens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 120
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Rustic Shoulder-knot

The Rustic Shoulder-knot (Apamea sordens) is a moth of the family Noctuidae. It is distributed throughout the Palearctic ecozone (Europe, Russia, Turkey, Afghanistan, Tibet, Siberia, Yunnan, Amur, Russian Far East, Sakhalin, Japan) and is also found in North America.

Formerly Apamea finitima was considered a separate species and has also been classifies as a subspecies of Apamea basilinea, which is now also a synonym of Apamea sordens.

This species has a wingspan of 36–42 mm. The forewings are brown with mostly indistinct markings except for a narrow but distinctive black mark at the very base of the wing which gives the species its common name. The hindwings are greyish brown, darker towards the margin, with prominently dark venation. This moth flies at night in May and June [1] and is attracted to light and sugar.

The larva feeds on various grasses, including cereals (see list below). This species overwinters as a larva, feeding in mild weather throughout the season.

  1. ^ The flight season refers to the British Isles. This may vary in other parts of the range.

Contents

Subspecies

Recorded food plants

See.[1]

Habitat, Siberia

Habitat

Fields, grasslands, steppe.

References

  • Chinery, Michael Collins Guide to the Insects of Britain and Western Europe 1986 (Reprinted 1991)
  • Skinner, Bernard Colour Identification Guide to Moths of the British Isles 1984
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Listed in Hodges (1983) as Apamea finitima Guenee, 1852. Holarctic species with two subspecies occuring in North America (finitima and sableana).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!