Overview

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Apamea sordens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 124
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Apamea sordens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AACATTATATTTTATTTTTGGGATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTAATAATTCGAGCCGAATTAGGAAATCCCGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATACTAGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGATTATTACCCCCCTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTGTATCCCCCACTTTCATCCAACATTGCCCATGGAGGAAGTTCCGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATCTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACCGCATTTTTATTATTACTATCTCTACCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATCTGAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rustic Shoulder-knot

The Rustic Shoulder-knot (Apamea sordens) is a moth of the family Noctuidae. It is distributed throughout Europe, Asia, and North America.

Habitat in Siberia

This moth has a wingspan of 36 to 42 mm. The forewings are brown with mostly indistinct markings except for the narrow black mark at the base of the wing which gives the species its common name. The hindwings are greyish brown, darker towards the margins, with prominent dark venation. This moth flies at night and is attracted to light and sugar. Its flight season in the British Isles is May and June.

The larva feeds on various grasses, including oats, fescues, barleys, canarygrasses, timothy, ryes, wheats, and wild rice.[1] This species overwinters as a larva, feeding in mild weather throughout the season.

Its habitat includes fields, grasslands, and steppe.

Subspecies[edit]

Notes[edit]

References[edit]

  • Chinery, M. Collins Guide to the Insects of Britain and Western Europe. 1986 (Reprinted 1991).
  • Skinner, B. Colour Identification Guide to Moths of the British Isles. 1984.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Listed in Hodges (1983) as Apamea finitima Guenee, 1852. Holarctic species with two subspecies occuring in North America (finitima and sableana).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!