Overview

Brief Summary

There are 32 species of lancet. These simple animals look like tiny, clear fish without fins. Lancets burrow into the sand in shallow waters, leaving only their heads sticking out. The Florida Lancet is found in the Gulf of Mexico. In some areas there are several hundred Florida Lancet per square foot.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Sebastian Velvez

Supplier: Life on Earth

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Gulf of Mexico, West Central Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Paratype for Branchiostoma floridae
Catalog Number: USNM 39380
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Moser
Year Collected: 1887
Locality: Northwest end of St. Martins Reef, Florida Banks., Florida, United States, Gulf of Mexico, Atlantic
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 49723
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Benedict
Year Collected: 1901
Locality: Tampa Bay, Florida., Florida, United States, Gulf of Mexico, North America, Atlantic
Vessel: Fish Hawk
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 49719
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Benedict
Year Collected: 1901
Locality: Tampa Bay, Florida., Florida, United States, Gulf of Mexico, North America, Atlantic
Vessel: Fish Hawk
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 49724
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Benedict
Year Collected: 1901
Locality: Tampa Bay, Florida., Florida, United States, Gulf of Mexico, North America, Atlantic
Vessel: Fish Hawk
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 49722
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Benedict
Year Collected: 1901
Locality: Tampa Bay, Florida., Florida, United States, Gulf of Mexico, Atlantic
Vessel: Fish Hawk
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 49721
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Benedict
Year Collected: 1901
Locality: Tampa Bay, Florida., Florida, United States, Gulf of Mexico, Atlantic
Vessel: Fish Hawk
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 49720
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Benedict
Year Collected: 1901
Locality: Tampa Bay, Florida., Florida, United States, Gulf of Mexico, Atlantic
Vessel: Fish Hawk
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 43877
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Henderson & C. Simpson
Year Collected: 1891
Locality: Tampa B., Florida., Florida, United States, Gulf of Mexico, Atlantic
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 44660
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Benedict & J. Kaiser
Year Collected: 1893
Locality: Pensacola Harbor, Florida., Escambia County, Florida, United States, Gulf of Mexico, Atlantic
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 44434
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Tait
Year Collected: 1893
Locality: Fort Tampa, Florida., Florida, United States, Gulf of Mexico, Atlantic
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 43557
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1889
Locality: Florida, United States, Gulf of Mexico, Atlantic
Vessel: Grampus
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 43556
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Year Collected: 1889
Locality: Collier County, Florida, United States, Gulf of Mexico, Atlantic
Vessel: Grampus
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Branchiostoma floridae
Catalog Number: USNM 84466
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Florida, United States, Gulf of Mexico, Atlantic
  • Type: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 92366
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Benedict & Kauser
Year Collected: 1893
Locality: Pensacola, Escambia County, Florida, United States, Gulf of Mexico, Atlantic
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Branchiostoma floridae
Catalog Number: USNM 92365
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Henderson & Simpson
Year Collected: 1901
Locality: Florida, United States, Gulf of Mexico, Atlantic
  • Paratype: ; Hubbs, C. L. 1922. Occasional Papers of the Museum of Zoology, University of Michigan. No. 105: 7.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 4 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1.5 - 1.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Branchiostoma floridae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 27 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGTACATTACTCGATGGTTATTTTCTACAAACCACAAAGATATCGGAACTTTATATTTTATTTTTGGTGCTTGAGCTGCAATGGTGGGGACTGCTATAAGTTTGCTAATTCGAGCAGAACTGTCTCAGCCGGGTGCGCTTTTAGGTGATGACCACTTATATAATGTAATTGTAACAGCGCACGCGTTTGTTATAATCTTCTTCATAGTTATGCCAATTATGATTGGGGGATTTGGGAATTGGTTAGTGCCCATGATAATTGGGGCGCCAGATATAGCTTTCCCCCGTATAAATAATATGAGCTTTTGAATGCTACCGCCGTCATTTTCTTTATTATTGGCGTCTTCTGCTGTCGAGGCTGGGGTTGGAACGGGTTGGACAGTTTACCCTCCTTTATCTAGTAACATTGCTCACGCAGGGGCATCTGTTGATCTGGCTATTTTCTCTCTACATTTGGCTGGTGTATCATCCATTTTAGGGGCAATCAATTTTATTACAACGATTCATAATATGCGTGCTAGCATTGAGTGAAATCGGGTGCCGTTGTTTGTTTGGTCAATTTGAGTTACTGCCTACCTATTGCTATTGTCCTTGCCAGTGTTAGCCGGTGCAATTACTATACTGCTTACTGATCGGAATATTAACACTACATTCTTCGATCCTTCCGGTGGAGGAGATCCAATTTTGTATGAGCATCTATTTTGATTCTTTGGTCATCCAGAAGTTTACATTTTAATTTTACCGGGGTTTGGTATTATTTCACATATTATTATTCACTATGCTGGTAAATTACGGTCATTTGGTTATTTAGGTATAACATGAGCTATGTTTACGATCGGGTTACTGGGGTTCTGGGTCTGAGCCCATCATATGTTTACTGTTGGTATAGATGTAGACACACGAAGTTATTTTACTGCCGCGACTATGGTTATTGCAGTTCCAACAGGAATTAAGGTTTTTAGCTGGTTAGCTACATTATCTGGATCAAAGCAATTAAAGTGGGAAACACCTCTATTATGAGCGCTAGGGTTCATCTTTTTATTCACTGTTGGAGGGTTAACTGGAATTGTACTAGCAAATTCGTCTTTAGACATTGTGTTGCATGATACATATTATGTTGTAGCACATTTTCATTACGTTTTGTCTATAGGAGCCGTATTTTCAATTTTAGCTGGACTTACATATTGGTTTCCTTTATTTACAGGATTTACGTTACAGGAGTCCTGGACAAAAATTCACTTCTTTGTAATATTTGTAGGGGTAAATTTAACGTTTTTTCCCCAGCATTTTTTAGGGTTGGCAGGTATACCTCGTCGATATTCTGACTACCCAGATGCATATACAATCTGAAATGTAATTTCATCTTTAGGGTCAATTATTTCTCTTGGGTCTGTAGTATTCTTTTTATTCATTTTGTGAGAAGCATTCTCATCTCAGCGGAAAGCCGTGCCAGCTAGTCATGCATCTCATTCTGCAGAGTGGTTAATAGGGTGTCCACCATTATTTCATACACATGAAGAGTTACCTTTTATTTCAAAGAAATATTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Branchiostoma floridae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 25
Specimens with Barcodes: 25
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Branchiostoma floridae

Branchiostoma floridae is a lancelet of the genus Branchiostoma. The genome of this species has been sequenced, revealing that among the chordates, the morphologically simpler tunicates are actually closer related to vertebrates than lancelets.[1]

References

  1. ^ Putnam, H.; Butts, T.; Ferrier, E.; Furlong, F.; Hellsten, U.; Kawashima, T.; Robinson-Rechavi, M.; Shoguchi, E. et al. (Jun 2008). "The amphioxus genome and the evolution of the chordate karyotype". Nature 453 (7198): 1064–1071. Bibcode:2008Natur.453.1064P. doi:10.1038/nature06967. ISSN 0028-0836. PMID 18563158.  edit


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!