Overview

Brief Summary

Ornithodoros species are soft ticks (Family Argasidae). Included in this genus is Ornithodoros moubata, an important vector of tick-borne relapsing fever (TBRF) in humans in parts of Africa. Ornithodoros moubata transmits the spirochaete bacterium Borrelia duttonii, which causes TBRF. (Louse-borne relapsing fever [LBRF], the occurrence of which has been greatly reduced in recent decades, is caused by B. recurrentis, which genetic studies suggest may be a louse-adapted form of B. duttonii.) TBRF remains a major cause of child mortality in some African counries. TBRF may also be caused by B. crocidurae (transmitted by the soft tick O. sonrai) in West Africa and B. hispanica (transmitted by the soft tick O. erraticus) in North Africa, with B. duttonii dominating in East Africa, but this is not clearly established. (Cutler et al. 2009)

Like other argasids, Ornithodoros ticks have multihost life cycles. Argasid ticks have two or more nymphal stages, each requiring a blood meal from a host. Unlike the ixodid (hard) ticks, which stay attached to their hosts for up to several days while feeding, most argasid ticks are adapted to feeding rapidly (for about an hour), then dropping off the host.

(Centers for Disease Control Parasites and Health website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Resler et al. (2009) studied the movements of spermatozoa in the reproductive tract of female Ornithodoros moubata soft ticks, which become more pronounced after a blood meal.

  • Resler, J.H., J.L. Frazier, J.G. Shepherd, et al. 2009. Migration and motility of spermatozoa in the female reproductive tract of the soft tick Ornithodoros moubata (Acari, Argasidae). Parasitology 136(5): 511-521.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ornithodoros moubata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCGCGATGATTTTATTCAACAAACCACAAAGACATTGGAACTATATACTTACTATTGGGGTCTTGATCAATAATAATTGGGATATCACTAAGAATTTTAATTCGAGTTGAACTTGGACAACCTGGTTCATTTATTGGTAAT---GACCAAGTTTATAACGTTATTGTTACAGCTCACGCCTTTGTTATAATTTTTTTTATAGTAATACCAATCATAATTGGTGGATTTGGAAACTGGCTTATTCCAATTATACTTGGAACTCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCACCCTCTTTAAGTCTTTTATTAACTTCATCCATAGTAGAAAATGGGGCAGGAACTGGTTGAACAGTATACCCCCCCCTAGCTTCAAACATATCTCACTCTGGGATGTCCGTTGATCTAGCAATTTTTAGCTTACATCTAGCTGGAATTTCATCCATTTTAGGTTCTATCAACTTTATCACAACTATTATAAATATACGACCAAAAGGAATAACTCTTGAACGAATCCCACTATTTTTATGATCAACTTTAATTACAACAATTTTATTACTTTTATCACTACCTGTTTTAGCAGGAGCTATCACTATACTTGTAACAGATCGAAATTTCAACACATCTTTTTTCGACCCAGCAGGGGGAGGAGACCCTATTTTATATCAACATTTATTTTGGTTTTTTGGTCACCCAGAGGTATACATTTTAATTCTTCCCGGATTTGGAATAATCTCTCATATTATCTGTTTCCAAACAGGAAAACGCGAGCCGTTTGGAACCCTAGGTATAATCTATGCAATGTTAGCAATTGGTCTTTTAGGTTTTATTGTATGAGCTCACCATATATTCACTGTTGGAATAGATGTTGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ornithodoros moubata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ornithodoros moubata

Ornithodoros moubata is a species of tick. It may be a vector of relapsing fever.[1]

See also

References




Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!