Overview

Brief Summary

Ixodes scapularis, the Black-legged Tick (often known as the "Deer Tick"), is best known as an important vector in the eastern United States of Lyme borreliosis (Lyme Disease), the most prevalent tick-transmitted infection not only in this region but, more generally, in temperate areas of Europe, North America, and Asia. (In the western United States and Europe, the main Lyme disease vectors are the related ticks I. pacificus and I. ricinus, respectively.) This tick was formerly known as I. dammini, but in 1993 this name was shown to be a junior synonym of I. scapularis. Lyme disease occurs only sporadically in the southern United States. (Patnaude and Mather 2000 and references therein)

The distribution and abundance of I. scapularis is closely tied to that of its primary reproductive host, the White-tailed Deer (Odocoileus virginianus). As large-scale changes in the landscape of the eastern United States have led to large increases in deer populations, I. scapularis populations appear to have increased as well. (Patnaude and Mather 2000 and references therein) A similar pattern seems to be evident for I. ricinus in western Europe as well (Jongejan and Uilenberg 2004).

Ixodes scapularis are small ticks, around 3 mm, and are dark brown to black in color. On females, the area behind the scutum is typically orange to red. This species is a three-host tick, i,e., the larva, nymph, and adult each feed on a different host. In June and July, eggs deposited earlier in the spring hatch into tiny six-legged larvae. Peak larval activity occurs in late summer, when larvae attach to and feed on a wide variety of mammals and birds, notably White-footed Mice (Peromyscus leucopus). After feeding for three to five days, engorged larvae drop from the host to the ground, where they overwinter. In late spring, larvae molt into nymphs, which feed on a variety of hosts for three to four days. Once engorged, a nymph detaches and drops to the forest floor where it molts into the adult stage, which becomes active in the late autumn. Adult female ticks feed for five to seven days, but males feed only sparingly, if at all. Adult ticks remain active through the winter on days when the ground and ambient temperatures are above freezing. (Patnaude and Mather 2000 and references therein)

Ixodes scapularis is an important vector of the Lyme disease spirochete Borrelia burgdorferi, the Babesia protozoans that cause human babesiosis, and Anaplasma phagocytophilum (formerly known a Ehrlichia phagocytophilum), the bacteria that cause human granulocytic anaplasmosis (formerly known as human granulocytic ehrlichiosis). (Patnaude and Mather 2000 and references therein)

United States Department of Agriculture researchers have developed a remarkably effective method for controlling populations of deer-dependent ticks, such as I. scapularis and Amblyomma americanum (Lone Star Tick). This device, known as a "4-Poster Deer Treatment Bait Station", rolls acaricide on a deer as it feeds from a feeding station (e.g., Pound et al. 2009).

(U.S. Centers for Disease Control and Prevention Ticks Website)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

The geographic range of Ixodes scapularis, the deer tick or blacklegged tick, consists of North America as a whole, also known as the Nearctic region. The climate in this region is favorable for their definitive host, the deer, and therefore they can be found in most areas of the United States occupied by deer. This includes the eastern coast of the United States, westward towards Texas, and northward into Minnesota. These ticks are also found in southeastern Canada, and northern Mexico, but it is very rare to find I. scapularis past these borders.

Biogeographic Regions: nearctic (Native )

  • Rand, P., C. Lubelczyk, G. Lavigne, S. Elias, M. Holman, E. Lacombe, R. Smith. 2003. Deer density and the abundance of Ixodes scapularis (Acari: Ixodidae). Journal of Medical Entomology, 40 (2): 179-184.
  • Wilson, M., G. Adler, A. Spielman. 1985. Correlation between abundance of deer and that of the deer tick, Ixodes dammini (Acari: Ixodidae). Annuals of the Entomology Society of America, 78: 172-176.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ixodes scapularis is approximately 3 mm in length. Females have a black head and dorsal shield, and a dark red abdomen. Males are entirely black or dark brown. Both sexes have eight legs that are black. This black legged tick also has a characteristic anal opening, which appears within a horseshoe-shaped ridge on the lower edge of the abdomen, on the ventral side. Deer ticks, unlike other ticks, do not have festoons (ridges on the edge of the lower abdomen).

In the larval state, the nymph has a dark head, with a translucent body. Like the adult, the nymph has four pairs of dark legs, but is smaller, measuring at about 1-2 mm in length.

Range length: 1 to 3 mm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; female more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Ixodes scapularis is a non-nidiculous tick species. In the larval state, the tick feeds on a variety of mammals and birds, but most prevalently the white-footed mouse. As the tick becomes an adult, it feeds mainly on large mammals, primarily white-tailed deer.

Habitat and microclimates are still crucial in the establishment and survival of this tick species. Even in areas of high deer population, the deer tick may not be found. Moving towards 175 m elevation, populations decline. In addition to elevation, coastal proximity is important. Ixodes sculparis seems to thrive in humid environments, and may also be assisted through dispersal by neotropical songbirds that are migrating in/through the area.

Range elevation: 0 to 175 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban ; agricultural

  • Anderson, J., L. Magnarelli. 1980. Vertebrate host relationships and distribution of ixodid ticks (Acari: Ixodidae) in Connecticut, USA. Journal of Medical Entomology, 17: 314-323.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Larval ticks of the Ixodes scapularis feed once on the blood of white-footed mice, or other small mammals. As they progress through the life cycle, nymphal ticks continue to feed on the blood of white-footed mice and other small mammals, sometimes moving to raccoons or medium sized mammals. After the final metamorphosis, female adult ticks feed on the blood of larger mammals, such as deer. Males do not feed on blood, but instead live only to mate.

In each of the life cycle states, Ixodes scapularis feeds only once, for 3-5 days.

Animal Foods: blood

Primary Diet: carnivore (Sanguivore , Eats body fluids)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Ixodes scapularis is parasitic throughout its life on the white-footed mouse, small mammals and birds, and the white-tailed deer. In addition to being a parasite, I. scapularis is also a vector of Lyme disease, caused by Borrelia burgdorferi. This tick is also known to be a vector of human babesiosis, Babesia microti, and human granulolytic erlichosis.

Ecosystem Impact: parasite

Species Used as Host:

Commensal/Parasitic Species:

  • Des Vignes, F., D. Fish. 1997. Transmission of the agent of human granulocytic ehrlichiosis by host-seeking Ixodes scapularis (Acari: Ixodidae) in southern New York State. Journal of Medical Entomology, 34: 379-382.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Ixodes scapularis is very rarely affected by predators. Due to its small size, this tick is rarely targeted or found by birds or other possible predators. Instead, it is highly affected by density-independent factors such as climate with temperature and humidity changes.

  • Bertrand, M., M. Wilson. 1996. Microclimate-dependent survival of unfed adult Ixodes scapularis (Acari: Ixodidae) in nature: life cycle and study design implications. Journal of Medical Entomology, 33: 619-627.
  • Matthewson, M. 1984. The future of tick control: A review of the chemical and non-chemical options. Previews of Veterinary Medicine, 2: 559-568.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Potential mates communicate through aggregating pheromones. Otherwise, Ixodes scapularis is a solitary tick and does not communicate with other species.

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Ixodes scapularis is a three-host tick, meaning that each stage of development reattaches to a host.

Eggs are deposited in the spring, and hatch in the summer. Starting in June, eggs deposited earlier in the spring hatch into tiny larvae. The larval activity is at its highest intensity in August, when larvae attach and feed on a wide variety of mammals and birds, but primarily on white-footed mice, Peromyscus leucopus.

After three to five days of feeding, engorged larvae leave their first host and drop to the ground where they remain through the winter and most of the spring. After this period, larvae molt into nymphs, which feed on a variety of hosts, generally small mammals, for three to four days. As is the case with the larvae, engorged nymphs detach and drop to the forest floor where they molt into an adult. This adult stage becomes active in October and remains active through winter days. Adult female ticks feed upon their definitive host, the white-tailed deer, for five to seven days while the male tick rarely feeds at all. Ixodes scapularis mates upon its host, with the male dying shortly after copulation. Once through the winter, engorged adult females typically lay eggs on the forest floor after they have detached from their white-tailed deer host.

Development - Life Cycle: metamorphosis

  • Troughton, D., M. Levin. 2007. Life cycles of seven ixodid tick species (Acari: Ixodidae) under standardized laboratory conditions. Journal of Medical Entomology, 44 (5): 732-740.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Ixodes scapularis lives approximately two years in the wild. Its life cycle is dependent more on reproduction than predation due to the tick's smaller size which is undetectable by birds. Males generally die after mating with one or more females, while females die after laying their eggs. Therefore, Ixodes scapularis lives until reproduction. Other effects on lifespan are density-independent such as temperature and humidity changes.

Average lifespan

Status: wild:
2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mate-finding and courtship behavior in Ixodes scapularis is largely regulated by pheromones, chemicals produced by one organism that attract other organisms. These pheromones cause ticks to aggregate on the ground, host, or vegetation. This causes contact between the sexes.

The deer tick is polygynous, with the female mating with one male, and males mating with as many females as possible. Generally the males inseminate 2-3 times. While males may attempt to mate with females who have already mated, there is a system in place to stop other males from mating with already inseminated females. Mating can take place on either the host, or vegetation in their region.

Mating System: polygynous

While ejaculatory pheromones are used by many other tick species, they have not yet been found in Ixodes ticks. Males require a set of cues to inseminate the female. Without such cues, males will either self-abort copulation within a few minutes of engagement or will remain in copula for hours or days without delivering a spermatophore. Insemination does not necessarily follow courtship in these ticks.

Ixodes ticks continue their intercourse even after the transfer of sperm. Ixodes scapularis males require less than one hour to inseminate the female, however the mean time of copulation is about 2.5 hours.

Breeding interval: Ixodes scapularis breeds once yearly.

Breeding season: The deer tick breeds in the late spring, usually in May.

Average number of offspring: 810.

Average age at sexual or reproductive maturity (female): 29-31 weeks.

Average age at sexual or reproductive maturity (male): 29-31 weeks.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

The male Ixodes scapularis dies after it has completed mating with one or more females, and the female dies after laying eggs. As such, there is no parental investment after fertilization.

Parental Investment: pre-fertilization (Protecting: Female)

  • Kiszewski, A., F. Matuschka, A. Spielman. 2001. Mating strategies and spermiogenesis in ixodid ticks. Annual Review of Entomology, 46: 167-182.
  • Kiszewski, A., A. Spielman. 2002. Preprandial inhibition of re-mating in Ixodes ticks (Acari:Ixodidae). Journal of Medical Entomology, 39 (6): 847-853.
  • Yuval, B., R. Deblinger, A. Spielman. 1990. Mating behavior of male deer ticks Ixodes dammini (Acari: Ixodidae). Journal of Insect Behavior, 3 (6): 765-772.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Receptors detect ruminant hosts: hard ticks
 

Some hard tick species detect ruminant hosts via olfactory receptor cells for the carboxylic acid, phenol and indole endproducts they expel.

   
  "Hard ticks spend most of their life isolated from passing vertebrates but require a blood meal to proceed to the next life stage (larva, nymph or adult). These opportunist ectoparasites must be capable of anticipating signals that render suitable hosts apparent. Large ungulates that tolerate a high ectoparasite burden are the favoured hosts of adult hard ticks. Ruminants, comprising the majority of ungulate species, must regularly eruct gases from the foregut to relieve excess pressure and maintain a chemical equilibrium. Through eructations from individuals, and particularly herds, ruminants inadvertently signal their presence to hard ticks. Here, we report that all adult hard tick species we tested are attracted to cud and demonstrate that these acarines possess olfactory receptor cells for the carboxylic acid, phenol and indole endproducts of the rumen bioreactor. Compounds from each of these classes of volatiles attract ticks on their own, and mixtures of these volatiles based on rumen composition also attract. Appetence for rumen metabolites represents a fundamental resource-tracking adaptation by hard ticks for large roaming mammals." (Donze et al. 2004:4283)
  Learn more about this functional adaptation.
  • Donze, G.; McMahon, C.; Guerin, P. M. 2004. Rumen metabolites serve ticks to exploit large mammals. Journal of Experimental Biology. 207(24): 4283-4289.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ixodes scapularis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACTATATATTTAATTTTTGGAAGCTGAGCAACTATAGTAGGAATATCTATAAGAATTTTAATTCGGACTGAATTAGGTCAACCTGGATCATTAATTGGTAATGACCAAATTTATAATGTTATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTAATACCTGTAATAATTGGTGGTTTTGGTAATTGGTTAATCCCATTAATGTTAGGGGCACCGGACATAGCTTTCCCTCGTATAAACAATTTAAGCTTCTGGTTATTACCACCCTCTTTATTTTTATTAATTAACTCTTCTTTAGTAGAAAGGGGGGCAGGAACAGGCTGAACAGTATACCCCCCACTTTCATCTAACATTTCCCACTCTGGTGCTTCTGTTGATATAGCAATTTTTTCCCTTCATTTAGCAGGTATTTCTTCAATTTTAGGGGCAATTAACTTTATTACAACAATTATTAATATACGATCTCCTGGAATATCTCTTGAACGTATACCATTATTTGTATGATCAGTTTTTATCACAGCAATTTTACTTCTTCTATCTCTTCCTGTTCTTGCTGGCGCAATTACAATGTTATTAACAGACCGTAATTTTAATACTTCGTTCTTTGACCCTTCTGGAGGAGGTGACCCTATTTTGTATCAACATTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ixodes scapularis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 374
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Due to the high population of deer in the northeastern United States, the deer tick has not become endangered in any manner. The species is thriving in it's current habitats.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Ixodes scapularis is a vector of Lyme disease, caused by Borrelia burgdorferi. Lyme disease can be debilitating to humans by causing fatigue and ultimately problems with the central nervous system. Ixodes scapularis is also known to be a vector of human babesiosis, Babesia microti, and human granulolytic erlichosis.

Negative Impacts: injures humans (carries human disease)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

There is no known positive economic importance for humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Ixodes scapularis

Ixodes scapularis is commonly known as the deer tick or blacklegged tick (although some people reserve the latter term for Ixodes pacificus, which is found on the West Coast of the USA), and in some parts of the USA as the bear tick.[1] It is a hard-bodied tick (family Ixodidae) of the eastern and northern Midwestern United States. It is a vector for several diseases of animals, including humans (Lyme disease, babesiosis, anaplasmosis, etc.) and is known as the deer tick owing to its habit of parasitizing the white-tailed deer.

Deer tick

Contents

Description

Engorged deer tick

The image shown at the upper right—and in fact, most images of Ixodes scapularis that are commonly available—show an adult that is unengorged, that is, an adult that has not had a blood meal. This is natural, since the ticks are generally removed immediately upon discovery to minimize the chance of disease. However, the abdomen that holds blood is so much larger when engorged and looks so different from the rest of the tick that it would be easy to assume that an engorged specimen of Ixodes scapularis is an entirely different tick (see photo at left).

When the deer tick has consumed a blood meal its abdomen will be a light grayish-blue color, whereas the tick itself is chiefly black. In identifying an engorged tick it is helpful to concentrate on the legs and upper part of the body.

Behavior

I. scapularis has a two-year life cycle, during which time it passes through three stages: larva, nymph, and adult. The tick must take a blood meal at each stage before maturing to the next. Deer tick females latch onto a host and drink its blood for four to five days. After she is engorged, the tick drops off and overwinters in the leaf litter of the forest floor. The following spring, the female lays several hundred to a few thousand eggs in clusters.[2] Transtadial (between tick stages) passage of Borrelia burgdorferi is common. Vertical passage (from mother to egg) of Borrelia is uncommon.

Ticks are very hardy creatures and I. scapularis is no exception. Expect them to be active even after a moderate to severe frost, as daytime temperatures can warm them enough to keep them actively searching for a host. In the spring, they can be one of the first invertebrates to become active. Deer ticks can be quite numerous and seemingly gregarious in areas where they are found.

As disease vector

Deer tick

Ixodes scapularis is the main vector of Lyme disease in North America.[3] It can also transmit other Borrelia species, including Borrelia miyamotoi.[4]

Ixodes ticks also can transmit Ehrlichia, a gram-negative obligate intracellular bacteria that is responsible for Ehrlichiosis.

Ticks that transmit Borrelia burgdorferi to humans can also carry and transmit several other parasites, such as Theileria microti and Anaplasma phagocytophilum, which cause the diseases babesiosis and human granulocytic anaplasmosis, respectively.[5] Among early Lyme disease patients, depending on their location, 2%–12% will also have HGA and 2%–40% will have babesiosis.[6]

Co-infections complicate Lyme symptoms, especially diagnosis and treatment. It is possible for a tick to carry and transmit one of the co-infections and not Borrelia, making diagnosis difficult and often elusive. The Centers for Disease Control's emerging infectious diseases department did a study in rural New Jersey of 100 ticks, and found 55% of the ticks were infected with at least one of the pathogens.[7]

See also

References

  1. ^ Drummond, Roger (2004). Ticks and What You Can Do about Them (3rd ed.). Berkeley, California: Wilderness Press. pp. 23. ISBN 0-89997-353-1.
  2. ^ Suzuki, David; Grady, Wayne (2004). Tree: A Life Story. Vancouver: Greystone Books. pp. 110. ISBN 1-55365-126-X.
  3. ^ Brownstein, John S.; Holford, Theodore R.; Fish, Durland (2005). "Effect of Climate Change on Lyme Disease Risk in North America". EcoHealth 2 (1): 38–46. doi:10.1007/s10393-004-0139-x. PMC 2582486. PMID 19008966. //www.ncbi.nlm.nih.gov/pmc/articles/PMC2582486/.
  4. ^ McNeil, Donald (19 September 2011). "New Tick-Borne Disease Is Discovered". The New York Times. pp. D6. Retrieved 20 September 2011. 
  5. ^ Steere AC (July 2001). "Lyme disease". New England Journal of Medicine 345 (2): 115–25. doi:10.1056/NEJM200107123450207. PMID 11450660.
  6. ^ G. P. Wormser (June 2006). "Clinical practice. Early Lyme disease". New England Journal of Medicine 354 (26): 2794–801. doi:10.1056/NEJMcp061181. PMID 16807416.
  7. ^ Varde S, Beckley J, Schwartz I (1998). "Prevalence of tick-borne pathogens in Ixodes scapularis in a rural New Jersey County". Emerging Infectious Diseases 4 (1): 97–99. doi:10.3201/eid0401.980113. PMC 2627663. PMID 9452402. http://www.cdc.gov/ncidod/eid/vol4no1/varde.htm.

See also

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!