Overview

Brief Summary

Dermacentor variabilis, often known as the American Dog Tick, is a 3-host tick that occurs mainly in the eastern United States (although it occurs outside this region as well), where adults are commonly encountered on dogs. These ticks generally feed on smaller mammals as larvae and nymphs and on larger mammals as adults. Although often found on dogs, these ticks will also feed on larger animals, such as cattle, horses, and even humans. Adults are vectors for Rocky Mountain spotted fever, tularemia, and canine tick paralysis. (Chan and Kaufman 2008 and references therein)

The 8-legged adult male and female D. variabilis ticks are typically brown to reddish-brown in color with gray/silver markings on their scutum (dorsal shield). Females have a very short scutum, present just behind the mouthparts, while the male scutum covers the majority of its dorsal surface. Once engorged with blood, a typical 5 mm female can enlarge to 15 mm in length and 10 mm in width. Larvae are yellow before blood-feeding and gray to black when engorged. Nymphs are a pale, yellowish brown before feeding; they become slate gray when engorged. Both larvae and nymphs have red markings near their eyes and lack any white on the scutum. Dermacentor variabilis ticks require a blood meal before progression from 6-legged larva to 8-legged nymph, and from nymph to adult, and adult females require a blood meal for egg production (typically laying between 4,000 and 6,500 eggs on the ground). Between each of these stages, the developing tick drops off its host and must then locate a new host for its next meal. Because larval and nymphal D. variabilis rarely bite humans, the adult tick is the primary stage of concern for humans. (Chan and Kaufman 2008 and references therein)

After hatching, larvae remain on the ground or climb onto vegetation, where they wait for small mammals, such as mice, to serve as hosts for their first blood meal. This host location behavior is known as "questing". Under favorable conditions, larvae can survive up to 11 months without feeding. After contacting and attaching to a host, larvae require from two to 14 days to complete blood feeding. After feeding, larvae detach from their host and fall to the ground, where they digest their blood meal and molt into the nymphal stage. This process can take as little as a week, although it often takes longer. Nymphs can survive six months without a blood meal. After successfully questing for their second host, which is typically a slightly larger mammal (such as a raccoon or opossum), the nymphs feed for three to 10 days. After engorging, they fall off the host, digest their blood meal and molt into an adult. This process can take anywhere from three weeks to several months. Adults can survive two years without feeding. Questing adult ticks climb onto a grass blade or other low vegetation, cling to it with their third pair of legs, and wave their other legs as a potential host approaches. As the hosts brush the vegetation, the ticks grab onto the passing animal. The complete life cycle requires at least 54 days to complete, but can take up to two years depending on host availability, host location, and ambient temperature. Mating occurs on the host and the female engorges within six to 13 days, after which she drops from the host to lay her eggs and then dies, thus completing the cycle. (Chan and Kaufman 2008 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Dermacentor variabilis, often known as the American Dog Tick, is a 3-host tick that occurs mainly in the eastern United States (although it occurs outside this region as well), where adults are commonly encountered on dogs. These ticks generally feed on smaller mammals as larvae and nymphs and on larger mammals as adults. Although often found on dogs, these ticks will also feed on larger animals, such as cattle, horses, and even humans. Adults are vectors for Rocky Mountain spotted fever, tularemia, and canine tick paralysis. (Chan and Kaufman 2008 and references therein)

The 8-legged adult male and female D. variabilis ticks are typically brown to reddish-brown in color with gray/silver markings on their scutum (dorsal shield). Females have a very short scutum, present just behind the mouthparts, while the male scutum covers the majority of its dorsal surface. Once engorged with blood, a typical 5 mm female can enlarge to 15 mm in length and 10 mm in width. Larvae are ~0.62 mm long and are yellow before blood-feeding and gray to black when engorged. Nymphs are about 0.9 mm long and a pale, yellowish brown before feeding; they become slate gray when engorged. Both larvae and nymphs have red markings near their eyes and lack any white on the scutum. Dermacentor variabilis ticks require a blood meal before progression from 6-legged larva to 8-legged nymph, and from nymph to adult ,and adult females require a blood meal for egg production. Between each of these stages, the developing tick drops off its host and must then locate a new host for its next meal. (Chan and Kaufman 2008 and references therein)

After five to 14 days of blood feeding, a fully engorged female D. variabilis drops from the host. She digests the blood meal and develops her egg clutch over the next four to 10 days. She then lays anywhere from 4,000 to 6,500 eggs on the ground. About 26 to 40 days later, depending on the temperature, the eggs hatch into larvae. After hatching, larvae remain on the ground or climb vegetation, where they wait for small mammals, such as mice, to serve as hosts for their first blood meal. This host location behavior is known as "questing". Under favorable conditions, larvae can survive up to 11 months without feeding. After contacting and attaching to a host, larvae require from two to 14 days to complete blood feeding. After feeding, larvae detach from their host and fall to the ground where they digest their blood meal and molt into the nymphal stage. This process can take as little as a week, although it often takes longer. Nymphs can survive six months without a blood meal. After successfully questing for their second host, which is typically a slightly larger mammal (such as a raccoon or opossum), the nymphs feed for three to 10 days. After engorging, they fall off the host, digest their blood meal and molt into an adult. This process can take anywhere from three weeks to several months. Adults can survive two years without feeding, but readily feed on dogs or other larger animals when available. Questing adult ticks climb onto a grass blade or other low vegetation, cling to it with their third pair of legs, and wave their other legs as a potential host approaches. As the hosts brush the vegetation, the ticks grab onto the passing animal. The complete life cycle requires at least 54 days to complete, but can take up to two years depending on host availability, host location, and ambient temperature. Mating occurs on the host and the female engorges within six to 13 days after which she drops from the host to lay her eggs and then dies, thus completing the cycle. (Chan and Kaufman 2008 and references therein)

Adult D. variabilis overwinter in the soil and are most active from around mid-April to early September. Larvae are active from about March through July and nymphs are usually found from June to early September. Dermacentor variabilis is the primary vector for the pathogen causing Rocky Mountain spotted fever (RMSF) and is also known to transmit the bacteria that cause tularemia. The ticks themselves can cause canine tick paralysis. Overwintering larvae can also acquire RMSF transovarially (mother to egg) yielding RMSF-infected larvae. Because larval and nymphal D. variabilis rarely bite humans, the adult tick is the primary stage of concern for humans. (Chan and Kaufman 2008 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

American dog ticks are found in the United States, mainly east of the Rocky Mountains (from Montana to south Texas), with some reports of the species from California and the Pacific Northwest, west of the Cascade and Sierra Nevada Mountains. They are most commonly found in the United States along the east coast. This species is also found in parts of Canada, east of Saskatchewan, as well as in northern Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

American dog ticks are typically larger than other Ixodes species, and are characterized by ornate, light-colored dorsal patterns including various shapes such as diamonds and other geometric designs on an otherwise brown to reddish-brown body. These ticks have rounded or oval bodies. Their coxae (first leg segments) are split into two parts, which have characteristic spurs. Shortened mouthparts and palps, along with their ornate dorsal patterns, distinguish American dog ticks from similar tick species. Adults and nymphs of this species have eight legs, though larvae have only six. Nymphs also lack a genital pore, which is found on the underside of adults.

This species is sexually dimorphic. Females range in size from 4 mm before a meal to as high as 15 mm long and 10 mm wide following, and their dorsal patterning only covers the anterior portion of their scutum (dorsal shields). Males are smaller and their patterning extends over the entire scutum.

Range length: 3.6 to 15 mm.

Average length: 4 mm.

Other Physical Features: ectothermic ; bilateral symmetry

Sexual Dimorphism: female larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

American dog ticks are generally found in forests, densely wooded areas, and grasslands, which support a large number possible hosts. They are also commonly found in areas regularly visited by potential mammalian hosts, such as vegetation on the sides of roads, near trails, and in grassy areas near highway rest stops.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: taiga ; savanna or grassland ; forest ; scrub forest ; mountains

Other Habitat Features: suburban ; agricultural ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

This species parasitizes almost all mammals and feeds exclusively on blood, making it an obligate sanguivore. Feeding occurs periodically for 3-11 days at a time and these animals can live for long periods of time without feeding, at all stages of development. Adult ticks, which consume greater quantities of blood, prefer larger hosts. Though this list is not all-inclusive, some specific mammals known to be hosts of this tick include dogs, humans, rabbits, raccoons, rats, mice, porcupines squirrels, and voles.

Animal Foods: blood

Primary Diet: carnivore (Sanguivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

American dog ticks are obligate ectoparasites in all stages of development. Larvae and nymphs target smaller mammals such as mice and other rodents, while adults target larger mammals such as dogs, raccoons, cattle, and humans. Different abundance patterns are observed for engorged and non-engorged ticks. For example, engorged tick abundance is primarily a function of host age, with younger hosts more easily supporting engorged ticks. Non-engorged tick abundance depends more on abiotic factors such as season or collection site. A wooded or grassy area in the spring will have a high abundance of non-engorged ticks.

American dog ticks are carriers of the pathogen which causes Rocky Mountain spotted fever (Rickettsia rickettsii, a type of coccobacillus), as well as Francisella tularensis (a bacteria), which causes tularemia, also known as "rabbit fever." They can also carry and transmit Cytauxzoon felis, a protozoan, from wild cats to domestic cats.

Ecosystem Impact: parasite

Species Used as Host:

  • Mammals

Commensal/Parasitic Species:

  • Blouin, E., A. Kocan, B. Glenn, K. Kocan, J. Hair. 1984. Transmission of Cytauxzoon fells Kier, 1979 from Bobcats, Felis rufus (Schreber), to Domestic Cats by Dermacentor variabilis (Say). Journal of Wildlife Diseases, 20/3: 241-242. Accessed January 24, 2013 at http://www.jwildlifedis.org/content/20/3/241.full.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although American dog ticks are very well protected by their exoskeletons, they do have some natural predators, including centipedes, newts, salamanders, skinks, spiders, toads and turkeys.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

These ticks locate hosts by climbing a blade of grass or small plant and extending their legs in anticipation of a mammal host. There is evidence suggesting that ticks "quest" on paths followed by mammals, led by their odors. Males are attracted to females by sensing pheromones. In addition, all ticks of the suborder Ixodida have a sense organ on their first legs termed Haller's Organ. This organ contains sensilla that are sensitive to carbon dioxide and infrared radiation, likely aiding them in locating hosts.

Communication Channels: tactile ; chemical

Other Communication Modes: pheromones ; scent marks ; vibrations

Perception Channels: infrared/heat ; tactile ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

American dog ticks hatch from eggs as 6-legged larvae and then become 8-legged nymphs, before finally reaching adulthood. A blood meal from a different host is required before each stage. This can make development a long process, as suitable hosts are not always readily available. After hatching, larvae wait on the ground for a small mammal host such as a mouse for their first blood meal. They then drop off this first host and wait for a second host, typically a larger mammal such as a raccoon. This process is repeated until adulthood is achieved, generally taking at least 54 days but possibly years, depending on host availability, as feeding takes several days at each stage and these animals may have to wait for several months to a year for subsequent hosts. After adult females find final hosts, they feed and engorge a last time before dropping off to mate, lay eggs, and die.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Longevity of American dog ticks depends on whether hosts are found for feeding in a appropriate amount of time. Larvae can survive 11 months before their first feeding, nymphal stages can survive 6 months without feeding, and adults can survive 2 years without feeding. The life cycle of this species can be completed in as few as 54 days but may take up to two years. Adult females die soon after breeding, while males may live to breed over multiple seasons.

Range lifespan

Status: wild:
2 to 24 months.

Average lifespan

Status: wild:
11 months.

  • Carrol, J., J. Nichols. 1986. Parasitization of meadow voles, Microtus pennsylvanicus (Ord), by American dog ticks, Dermacentor variabilis (Say), and adult tick movement during high host density. Journal of Entomological Science, 21: 102-113.
  • Goethert, H., S. Telford. 2009. Nonrandom Distribution of Vector Ticks (Dermacentor variabilis) Infected by Francisella tularensis. PLoS Pathogens, February 2009: 0-10. Accessed January 17, 2012 at http://www.plospathogens.org/article/info%3Adoi%2F10.1371%2Fjournal.ppat.1000319.
  • Lyon, W., R. Restifo. 1998. "Canine Vector-Borne Diseases" (On-line). American Dog Tick - Dermacentor variabilis. Accessed January 17, 2012 at http://www.cvbd.org/4208.0.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

American dog ticks mate once yearly, typically in mid-April after emerging from over-wintering in soil. Adult females partially engorge while on their host and then release pheromones to incite males to drop off their hosts. Once males have been attracted and copulation is complete, females finish feeding before dropping off to lay eggs. While females die after laying eggs and so only mate with one male, a single male may mate with multiple females.

Mating System: polygynous

American dog ticks reproduce sexually with breeding occurring in the spring (most typically in mid-April). Once a male has dropped off his host, attracted by pheromones released by a female, he approaches her. After making contact, a male mounts a female, locates her genital opening, and inserts a spermatophore into her using his mouthparts. Mating takes place on the host. Within 5-14 days, females drop from their hosts, fully engorged. Four to ten days later, once egg development is complete, females will lay up to 6500 eggs before dying. The number of eggs laid is positively correlated with temperature and amount of blood taken during the final blood meal, up to temperatures exceeding 35°C or final blood meals exceeding 665 mg.

Breeding interval: American dog ticks breed once yearly.

Breeding season: Breeding season is in the spring, most often mid-April.

Range number of offspring: 4000 eggs to 6500 eggs.

Range gestation period: 4 to 10 days.

Range age at sexual or reproductive maturity (female): 1 to 17 months.

Average age at sexual or reproductive maturity (female): 3 months.

Range age at sexual or reproductive maturity (male): 1 to 17 months.

Average age at sexual or reproductive maturity (male): 3 months.

Key Reproductive Features: semelparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); oviparous

Males exhibit no parental investment following copulation. Females protect and nourish eggs in the body, before dying after egg laying is complete. Once eggs hatch, larvae search for their first small mammal host without any parental assistance.

Parental Investment: female parental care ; pre-fertilization (Provisioning, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Antimicrobial peptides destroy bacteria: American dog tick
 

Defensins in the American dog tick destroys the bacteria that cause Lyme disease by introducing voltage-dependent channels into bacterial membranes.

     
  "Defensins are a family of antimicrobial peptides possessed by both vertebrates and invertebrates, which destroy invading bacteria by introducing voltage-dependent channels into bacterial membranes (Cociancich et al., 1993; Saido-Sakanaka et al., 1999 )…However, more is known about B. burgdorferi, the causative agent of Lyme disease. This well characterized spirochete is transmitted to humans when an infected I. scapularis tick in the nymph or adult stage feeds on a human. Interestingly, the tick D. variabilis is not a competent vector for B. burgdorferi because it destroys the spirochetes before they can be transmitted to a host (Johns et al., 2001a, 2001b)." (Todd et al. 2007:141, 146)
  Learn more about this functional adaptation.
  • Todd, S.M.; Sonenshine, D.E.; Hynes, W.L. 2007. Tissue and life-stage distribution of a defensin gene in the Lone Star tick, Amblyomma americanum. Medical and Veterinary Entomology. 21: 141-147.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dermacentor variabilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCGCGATGAATATATTCAACAAATCATAAAGACATTGGTACTATATACTTAATTTTCGGCAGTTGAGCAGGAGTCACAGGAATAAGAATAAGAATTTTAATTCGAATAGAGTTAAGCCAACCAGGAACTTTAATTGGAAAT---GATCAAATTTATAACGTAATTGTAACTGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCTATCATAATTGGTGGGTTTGGAAACTGACTTGTACCAATTATATTAGGAGCCCCAGACATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCATTATTTTTACTTATAAATTCTTCATTAATTGAATCAGGAGCAGGAACAGGTTGAACTGTTTATCCCCCTTTATCATCAAATTTGTCTCACTATGGACCTTCAGTTGATTTAGCTATTTTTAGCCTTCATCTAGCAGGTGCATCCTCTATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGATCAATTGGTTTAACTCTTGAACGAATACCTTTATTTGTTTGATCAGTTTTAATTACAGCAATTTTACTTCTTCTTTCTCTCCCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAACTTTAATACCTCCTTTTTTGATCCTTCAGGTGGTGGAGATCCTATTTTGTATCAACATCTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTCTACCTGGCTTTGGAATAATTTCTCAAATTATTTGTTTTTCCACAGGAAAAAAAGAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dermacentor variabilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

This species has no special conservation status.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

  • IUCN, 2012. "The IUCN Red List of Threatened Species" (On-line). Accessed January 26, 2013 at www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

American dog ticks are vectors for diseases such as Rocky Mountain spotted fever and tularemia. Dogs and humans may also be affected by tick paralysis if they become hosts. Rocky Mountain spotted fever is a disease that affects small blood vessels, causing an initial rash followed by other symptoms that include fever, vomiting, and diarrhea. There is an approximate 20% mortality rate if untreated, but ticks must remain attached for at least 6 hours in order to transmit the disease. Tularemia has a mortality rate of approximately 7% if untreated; symptoms include chills, fever, and swollen lymph nodes. Tick paralysis can occur in dogs and humans, and is caused by a neurotoxic protein produced in a tick's salivary glands that may enter the bloodstream during feeding. The mortality rate is about 10%, but individuals are likely to recover if the tick is removed.

Negative Impacts: injures humans (bites or stings, causes disease in humans ); causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species provides no known economic benefits to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dermacentor variabilis

Dermacentor variabilis, also known as the American dog tick or Wood tick, is a species of tick that is known to carry bacteria responsible for several diseases in humans, including Rocky Mountain spotted fever and tularemia (Francisella tularensis). It is one of the most well-known hard ticks. Diseases are spread when it sucks blood from the host, which could take several days for the host to experience some symptoms.

Though D. variabilis may be exposed to Borrelia burgdorferi, the causative agent of Lyme disease,[1] these ticks are not competent vectors for the transmission of this disease.[2][3][4] The primary vector for Borrelia burgdorferi is the deer tick Ixodes scapularis in Eastern parts of the United States, and Ixodes pacificus in California and Oregon. Dermacentor variabilis may also carry Anaplasma phagocytophilum, the causative agent of HGE (human granulocytic ehrlichiosis), and Ehrlichia chaffeensis, the causative agent of HME (human monocytic ehrlichiosis).[1]

Dermacentor ticks may also induce tick paralysis by elaboration of a neurotoxin that induces rapidly progressive flaccid quadriparesis similar to Guillain-Barré syndrome. The neurotoxin prevents presynaptic release of acetylcholine from neuromuscular junctions.

See also[edit]

Bibliography[edit]

References[edit]

  1. ^ a b Kevin Holden, John T. Boothby, Sulekha Anand & Robert F. Massung (2003). "Detection of Borrelia burgdorferi, Ehrlichia chaffeensis, and Anaplasma phagocytophilum in Ticks (Acari: Ixodidae) from a Coastal Region of California". J. Med. Entomol. 40 (4): 534–9. doi:10.1603/0022-2585-40.4.534. PMID 14680123. 
  2. ^ Joseph Piesman & Christine M. Happ (1997). "Ability of the Lyme disease spirochete Borrelia burgdorferi to infect rodents and three species of human-biting ticks (blacklegged tick, American dog tick, lone star tick) (Acari:Ixodidae)". J. Med. Entomol. 34 (4): 451–6. PMID 9220680. 
  3. ^ F. H. Sanders & J. H. Oliver (1995). "Evaluation of Ixodes scapularis, Amblyomma americanum, and Dermacentor variabilis (Acari: Ixodidae) from Georgia as vectors of a Florida strain of the Lyme disease spirochete, Borrelia burgdorferi". J. Med. Entomol. 32 (4): 402–426. PMID 7650697. 
  4. ^ Stanley W. Mukolwe, A. Alan Kocan, Robert W. Barker, Katherine M. Kocan & George L. Murphy (1992). "Attempted transmission of Borrelia burgdorferi (Spirochaetales: Spirochaetaceae) (JDI strain) by Ixodes scapularis (Acari: Ixodidae), Dermacentor variabilis, and Amblyomma americanum". J. Med. Entomol. 29 (4): 673–7. PMID 1495078. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!