Overview

Brief Summary

Dermacentor variabilis, often known as the American Dog Tick, is a 3-host tick that occurs mainly in the eastern United States (although it occurs outside this region as well), where adults are commonly encountered on dogs. These ticks generally feed on smaller mammals as larvae and nymphs and on larger mammals as adults. Although often found on dogs, these ticks will also feed on larger animals, such as cattle, horses, and even humans. Adults are vectors for Rocky Mountain spotted fever, tularemia, and canine tick paralysis. (Chan and Kaufman 2008 and references therein)

The 8-legged adult male and female D. variabilis ticks are typically brown to reddish-brown in color with gray/silver markings on their scutum (dorsal shield). Females have a very short scutum, present just behind the mouthparts, while the male scutum covers the majority of its dorsal surface. Once engorged with blood, a typical 5 mm female can enlarge to 15 mm in length and 10 mm in width. Larvae are yellow before blood-feeding and gray to black when engorged. Nymphs are a pale, yellowish brown before feeding; they become slate gray when engorged. Both larvae and nymphs have red markings near their eyes and lack any white on the scutum. Dermacentor variabilis ticks require a blood meal before progression from 6-legged larva to 8-legged nymph, and from nymph to adult, and adult females require a blood meal for egg production (typically laying between 4,000 and 6,500 eggs on the ground). Between each of these stages, the developing tick drops off its host and must then locate a new host for its next meal. Because larval and nymphal D. variabilis rarely bite humans, the adult tick is the primary stage of concern for humans. (Chan and Kaufman 2008 and references therein)

After hatching, larvae remain on the ground or climb onto vegetation, where they wait for small mammals, such as mice, to serve as hosts for their first blood meal. This host location behavior is known as "questing". Under favorable conditions, larvae can survive up to 11 months without feeding. After contacting and attaching to a host, larvae require from two to 14 days to complete blood feeding. After feeding, larvae detach from their host and fall to the ground, where they digest their blood meal and molt into the nymphal stage. This process can take as little as a week, although it often takes longer. Nymphs can survive six months without a blood meal. After successfully questing for their second host, which is typically a slightly larger mammal (such as a raccoon or opossum), the nymphs feed for three to 10 days. After engorging, they fall off the host, digest their blood meal and molt into an adult. This process can take anywhere from three weeks to several months. Adults can survive two years without feeding. Questing adult ticks climb onto a grass blade or other low vegetation, cling to it with their third pair of legs, and wave their other legs as a potential host approaches. As the hosts brush the vegetation, the ticks grab onto the passing animal. The complete life cycle requires at least 54 days to complete, but can take up to two years depending on host availability, host location, and ambient temperature. Mating occurs on the host and the female engorges within six to 13 days, after which she drops from the host to lay her eggs and then dies, thus completing the cycle. (Chan and Kaufman 2008 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Dermacentor variabilis, often known as the American Dog Tick, is a 3-host tick that occurs mainly in the eastern United States (although it occurs outside this region as well), where adults are commonly encountered on dogs. These ticks generally feed on smaller mammals as larvae and nymphs and on larger mammals as adults. Although often found on dogs, these ticks will also feed on larger animals, such as cattle, horses, and even humans. Adults are vectors for Rocky Mountain spotted fever, tularemia, and canine tick paralysis. (Chan and Kaufman 2008 and references therein)

The 8-legged adult male and female D. variabilis ticks are typically brown to reddish-brown in color with gray/silver markings on their scutum (dorsal shield). Females have a very short scutum, present just behind the mouthparts, while the male scutum covers the majority of its dorsal surface. Once engorged with blood, a typical 5 mm female can enlarge to 15 mm in length and 10 mm in width. Larvae are ~0.62 mm long and are yellow before blood-feeding and gray to black when engorged. Nymphs are about 0.9 mm long and a pale, yellowish brown before feeding; they become slate gray when engorged. Both larvae and nymphs have red markings near their eyes and lack any white on the scutum. Dermacentor variabilis ticks require a blood meal before progression from 6-legged larva to 8-legged nymph, and from nymph to adult ,and adult females require a blood meal for egg production. Between each of these stages, the developing tick drops off its host and must then locate a new host for its next meal. (Chan and Kaufman 2008 and references therein)

After five to 14 days of blood feeding, a fully engorged female D. variabilis drops from the host. She digests the blood meal and develops her egg clutch over the next four to 10 days. She then lays anywhere from 4,000 to 6,500 eggs on the ground. About 26 to 40 days later, depending on the temperature, the eggs hatch into larvae. After hatching, larvae remain on the ground or climb vegetation, where they wait for small mammals, such as mice, to serve as hosts for their first blood meal. This host location behavior is known as "questing". Under favorable conditions, larvae can survive up to 11 months without feeding. After contacting and attaching to a host, larvae require from two to 14 days to complete blood feeding. After feeding, larvae detach from their host and fall to the ground where they digest their blood meal and molt into the nymphal stage. This process can take as little as a week, although it often takes longer. Nymphs can survive six months without a blood meal. After successfully questing for their second host, which is typically a slightly larger mammal (such as a raccoon or opossum), the nymphs feed for three to 10 days. After engorging, they fall off the host, digest their blood meal and molt into an adult. This process can take anywhere from three weeks to several months. Adults can survive two years without feeding, but readily feed on dogs or other larger animals when available. Questing adult ticks climb onto a grass blade or other low vegetation, cling to it with their third pair of legs, and wave their other legs as a potential host approaches. As the hosts brush the vegetation, the ticks grab onto the passing animal. The complete life cycle requires at least 54 days to complete, but can take up to two years depending on host availability, host location, and ambient temperature. Mating occurs on the host and the female engorges within six to 13 days after which she drops from the host to lay her eggs and then dies, thus completing the cycle. (Chan and Kaufman 2008 and references therein)

Adult D. variabilis overwinter in the soil and are most active from around mid-April to early September. Larvae are active from about March through July and nymphs are usually found from June to early September. Dermacentor variabilis is the primary vector for the pathogen causing Rocky Mountain spotted fever (RMSF) and is also known to transmit the bacteria that cause tularemia. The ticks themselves can cause canine tick paralysis. Overwintering larvae can also acquire RMSF transovarially (mother to egg) yielding RMSF-infected larvae. Because larval and nymphal D. variabilis rarely bite humans, the adult tick is the primary stage of concern for humans. (Chan and Kaufman 2008 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Unknown/Undetermined

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Antimicrobial peptides destroy bacteria: American dog tick
 

Defensins in the American dog tick destroys the bacteria that cause Lyme disease by introducing voltage-dependent channels into bacterial membranes.

     
  "Defensins are a family of antimicrobial peptides possessed by both vertebrates and invertebrates, which destroy invading bacteria by introducing voltage-dependent channels into bacterial membranes (Cociancich et al., 1993; Saido-Sakanaka et al., 1999 )…However, more is known about B. burgdorferi, the causative agent of Lyme disease. This well characterized spirochete is transmitted to humans when an infected I. scapularis tick in the nymph or adult stage feeds on a human. Interestingly, the tick D. variabilis is not a competent vector for B. burgdorferi because it destroys the spirochetes before they can be transmitted to a host (Johns et al., 2001a, 2001b)." (Todd et al. 2007:141, 146)
  Learn more about this functional adaptation.
  • Todd, S.M.; Sonenshine, D.E.; Hynes, W.L. 2007. Tissue and life-stage distribution of a defensin gene in the Lone Star tick, Amblyomma americanum. Medical and Veterinary Entomology. 21: 141-147.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dermacentor variabilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCGCGATGAATATATTCAACAAATCATAAAGACATTGGTACTATATACTTAATTTTCGGCAGTTGAGCAGGAGTCACAGGAATAAGAATAAGAATTTTAATTCGAATAGAGTTAAGCCAACCAGGAACTTTAATTGGAAAT---GATCAAATTTATAACGTAATTGTAACTGCTCATGCATTTATTATAATTTTTTTCATAGTTATACCTATCATAATTGGTGGGTTTGGAAACTGACTTGTACCAATTATATTAGGAGCCCCAGACATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCATTATTTTTACTTATAAATTCTTCATTAATTGAATCAGGAGCAGGAACAGGTTGAACTGTTTATCCCCCTTTATCATCAAATTTGTCTCACTATGGACCTTCAGTTGATTTAGCTATTTTTAGCCTTCATCTAGCAGGTGCATCCTCTATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGATCAATTGGTTTAACTCTTGAACGAATACCTTTATTTGTTTGATCAGTTTTAATTACAGCAATTTTACTTCTTCTTTCTCTCCCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAACTTTAATACCTCCTTTTTTGATCCTTCAGGTGGTGGAGATCCTATTTTGTATCAACATCTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTTTAATTCTACCTGGCTTTGGAATAATTTCTCAAATTATTTGTTTTTCCACAGGAAAAAAAGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dermacentor variabilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Dermacentor variabilis

Dermacentor variabilis, also known as the American dog tick or Wood tick, is a species of tick that is known to carry bacteria responsible for several diseases in humans, including Rocky Mountain spotted fever and tularemia (Francisella tularensis). It is one of the most well-known hard ticks. Diseases are spread when it sucks blood from the host, which could take several days for the host to experience some symptoms.

Though D. variabilis may be exposed to Borrelia burgdorferi, the causative agent of Lyme disease,[1] these ticks are not competent vectors for the transmission of this disease.[2][3][4] The primary vector for Borrelia burgdorferi is the deer tick Ixodes scapularis in Eastern parts of the United States, and Ixodes pacificus in California and Oregon. Dermacentor variabilis may also carry Anaplasma phagocytophilum, the causative agent of HGE (human granulocytic ehrlichiosis), and Ehrlichia chaffeensis, the causative agent of HME (human monocytic ehrlichiosis).[1]

Dermacentor ticks may also induce tick paralysis by elaboration of a neurotoxin that induces rapidly progressive flaccid quadriparesis similar to Guillain-Barré syndrome. The neurotoxin prevents presynaptic release of acetylcholine from neuromuscular junctions.

See also[edit]

Bibliography[edit]

References[edit]

  1. ^ a b Kevin Holden, John T. Boothby, Sulekha Anand & Robert F. Massung (2003). "Detection of Borrelia burgdorferi, Ehrlichia chaffeensis, and Anaplasma phagocytophilum in Ticks (Acari: Ixodidae) from a Coastal Region of California". Journal of Medical Entomology 40 (4): 534–539. doi:10.1603/0022-2585-40.4.534. PMID 14680123. 
  2. ^ Joseph Piesman & Christine M. Happ (1997). "Ability of the Lyme disease spirochete Borrelia burgdorferi to infect rodents and three species of human-biting ticks (blacklegged tick, American dog tick, lone star tick) (Acari:Ixodidae)". Journal of Medical Entomology 34 (4): 451–456. PMID 9220680. 
  3. ^ F. H. Sanders & J. H. Oliver (1995). "Evaluation of Ixodes scapularis, Amblyomma americanum, and Dermacentor variabilis (Acari: Ixodidae) from Georgia as vectors of a Florida strain of the Lyme disease spirochete, Borrelia burgdorferi". Journal of Medical Entomology 32 (4): 402–426. PMID 7650697. 
  4. ^ Stanley W. Mukolwe, A. Alan Kocan, Robert W. Barker, Katherine M. Kocan & George L. Murphy (1992). "Attempted transmission of Borrelia burgdorferi (Spirochaetales: Spirochaetaceae) (JDI strain) by Ixodes scapularis (Acari: Ixodidae), Dermacentor variabilis, and Amblyomma americanum". Journal of Medical Entomology 29 (4): 673–677. PMID 1495078. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!