Overview
Comprehensive Description
Color: Variable, from light to red to violet or deep purple. Reverse counter-shading (the dorsal surface lighter than ventral surface) is pronounced in some species, absent in others.
- OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.
© Biologiezentrum Linz/Austria
Source:
Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems
Trusted
Members of Benthoctopus are typically more active and more apt to jet away from submersibles and ROVs than are other deep-sea octopus, making submersible-collected specimens rare. These octopuses sometimes extend their dorsal arms vertically into the water column, perhaps to enhance chemoreception. Egg-brooding females may aggregate on hard substrate where they often sit with the suckered surfaces of their arms facing away from the rock.
- OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.
© Biologiezentrum Linz/Austria
Source:
Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems
Trusted
Distribution
Octopuses of the genus Benthoctopus occur worldwide, typically between about 400 m rarely to as deep as 2000 m. Octopuses of Benthoctopus have been seen near vents at Juan de Fuca Ridge including Endeavour segment, and Gorda Ridge (where they brood eggs), and cold seeps off South America.
- OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.
© Biologiezentrum Linz/Austria
Source:
Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems
Trusted
Physical Description
Morphology
The genus is poorly delineated and is likely not monophyletic; it includes octopuses without an ink sac with two rows of arm suckers. Field identification of members of this genus relies on their smooth skin, double rows of suckers (which are distinct from zig-zag sucker rows of octopus of Graneledone), the comparatively narrow heads and mantles and, in some species, the mantle being lighter in dorsally than ventrally. Although internal examination of specimens is required to identify species, external characters such as coloration, eye size and, in a few species, dramatically enlarged suckers contribute to species identification.
- OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.
© Biologiezentrum Linz/Austria
Source:
Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems
Trusted
Size
Total lengths can approach one meter, but typically 50 cm or less.
- OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.
© Biologiezentrum Linz/Austria
Source:
Denisia 18 and ChEss - Biogeography of Deep-Water Chemosynthetic Ecosystems
Trusted
Ecology
Habitat
Depth range based on 109 specimens in 4 taxa.
Water temperature and chemistry ranges based on 67 samples.
Environmental ranges
Depth range (m): 88.5 - 3252.85
Temperature range (°C): -0.006 - 8.018
Nitrate (umol/L): 18.047 - 44.846
Salinity (PPS): 33.401 - 34.979
Oxygen (ml/l): 0.578 - 6.184
Phosphate (umol/l): 1.175 - 3.320
Silicate (umol/l): 15.017 - 181.171
Graphical representation
Depth range (m): 88.5 - 3252.85
Temperature range (°C): -0.006 - 8.018
Nitrate (umol/L): 18.047 - 44.846
Salinity (PPS): 33.401 - 34.979
Oxygen (ml/l): 0.578 - 6.184
Phosphate (umol/l): 1.175 - 3.320
Silicate (umol/l): 15.017 - 181.171
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 67 samples.
Environmental ranges
Depth range (m): 88.5 - 3252.85
Temperature range (°C): -0.006 - 8.018
Nitrate (umol/L): 18.047 - 44.846
Salinity (PPS): 33.401 - 34.979
Oxygen (ml/l): 0.578 - 6.184
Phosphate (umol/l): 1.175 - 3.320
Silicate (umol/l): 15.017 - 181.171
Graphical representation
Depth range (m): 88.5 - 3252.85
Temperature range (°C): -0.006 - 8.018
Nitrate (umol/L): 18.047 - 44.846
Salinity (PPS): 33.401 - 34.979
Oxygen (ml/l): 0.578 - 6.184
Phosphate (umol/l): 1.175 - 3.320
Silicate (umol/l): 15.017 - 181.171
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Statistics of barcoding coverage: Benthoctopus sp. B.
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Benthoctopus sp. A.
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Benthoctopus cf. rigbyae
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Benthoctopus sp.
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 18
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 18
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Benthoctopus sp. 1
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Benthoctopus sp. B
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Barcode data: Benthoctopus sp. CYV-2001
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
ACATTATATTTTATTTTTGGAATTTGATCAGGTCTACTAGGTACATCACTAAGATTAATAATTCGAACAGAACTAGGACAACCTGGATCTTTATTAAATGAT---GATCAACTCTATAACGTCATTGTTACTGCCCACGCTTTTGTAATAATTTTCTTTTTAGTTATACCCGTAATAATTGGAGGATTTGGAAACTGATTAGTTCCCTTAATATTGGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTACTTCCCCCATCTTTAACCCTCCTCTTAACCTCAGCAGCAGTAGAAAGAGGAGCAGGAACAGGTTGAACTGTTTATCCTCCATTATCTAGAAATTTAGCTCATATAGGCCCATCTGTAGATCTAGCAATTTTTTCTCTTCACTTAGCAGGTATTTCCTCTATTTTAGGAGCCATTAATTTTATCACAACTATCATTAATATACGATGAGAAGGAATACAAATAGAACGTCTTCCTTTATTTGTATGATCAGTTCTAATCACAGCAATCCTACTTCTATTATCATTACCAGTATTAGCAGGTGCAATCACCATACTTCTCACTGACCGTAATTTCAACACAACTTTTTTTGATCCTAGAGGAGGAGGAGATCCTATTCTATACCAACACTTATTT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Benthoctopus sp. CYV-2001
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage
Barcode of Life Data Systems (BOLD) Stats
| Specimen Records: | 63 | Public Records: | 1 |
| Specimens with Sequences: | 57 | Public Species: | 1 |
| Specimens with Barcodes: | 57 | Public BINs: | 1 |
| Species: | 11 | ||
| Species With Barcodes: | 10 | ||
© Barcode of Life Data Systems
Trusted
Barcode data
© Barcode of Life Data Systems
Trusted
Locations of barcode samples
© Barcode of Life Data Systems
Trusted
Genomic DNA is available from 2 specimens with morphological vouchers housed at Universidade do Minho
© Ocean Genome Legacy
Source:
Ocean Genome Resource
Trusted
Genomic DNA is available from 3 specimens with morphological vouchers housed at Universidade do Minho
© Ocean Genome Legacy
Source:
Ocean Genome Resource
Trusted
Wikipedia
Benthoctopus
Benthoctopus is a genus of octopuses comprising around 25 species. It is thus the most species-rich genus of the deep-sea subfamily Bathypolypodinae. They seem to occur worldwide, and most specimens have been brought up from depths of 200-3,000 m.[1]
Contents |
Species
New species are being described at a rate of approximately 1–2 per year on average.
- Benthoctopus abruptus
- Benthoctopus berryi
- Benthoctopus canthylus
- Benthoctopus clyderoperi
- Benthoctopus ergasticus
- Benthoctopus eureka (= B. hyadesi; tentatively placed here[1])
- Benthoctopus fuscus (nomen dubium[1])
- Benthoctopus hokkaidensis
- Benthoctopus januarii – January octopus
- Benthoctopus karubar
- Benthoctopus leioderma – smoothskin octopus
- Benthoctopus levis
- Benthoctopus longibrachus
- Benthoctopus lothei (nomen dubium)
- Benthoctopus macrophallus
- Benthoctopus magellanicus (nomen dubium; tentatively placed here[1])
- Benthoctopus oregonae
- Benthoctopus oregonensis
- Benthoctopus piscatorum
- Benthoctopus profundorum
- Benthoctopus pseudonymus (nomen dubium[1])
- Benthoctopus rigbyae[2]
- Benthoctopus robustus
- Benthoctopus sibiricus
- Benthoctopus tangaroa
- Benthoctopus tegginmathae
- Benthoctopus thielei
- Benthoctopus yaquinae
- Benthoctopus sp. A "Villarroel et al. 2001"[1]
- Benthoctopus sp. B "Villarroel et al. 2001"[1]
- Benthoctopus cf. januarii "Nesis 1973" (may be B. januarii or B. longibrachus)[1]
Footnotes
References
- Ibáñez, Christian M.; Sepúlveda, Roger D. & Chong, Javier (2006): A new species of Benthoctopus Grimpe, 1921 (Cephalopoda: Octopodidae) from the southeastern Pacific Ocean. Proceedings of the Biological Society of Washington 119(3): 355–364. DOI: 10.2988/0006-324X(2006)119[355:ANSOBG]2.0.CO;2 HTML abstract
Source:
Wikipedia
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
