Overview

Comprehensive Description

Color: Variable, from light to red to violet or deep purple. Reverse counter-shading (the dorsal surface lighter than ventral surface) is pronounced in some species, absent in others.
  • OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Members of Benthoctopus are typically more active and more apt to jet away from submersibles and ROVs than are other deep-sea octopus, making submersible-collected specimens rare. These octopuses sometimes extend their dorsal arms vertically into the water column, perhaps to enhance chemoreception. Egg-brooding females may aggregate on hard substrate where they often sit with the suckered surfaces of their arms facing away from the rock.
  • OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Octopuses of the genus Benthoctopus occur worldwide, typically between about 400 m rarely to as deep as 2000 m. Octopuses of Benthoctopus have been seen near vents at Juan de Fuca Ridge including Endeavour segment, and Gorda Ridge (where they brood eggs), and cold seeps off South America.
  • OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

The genus is poorly delineated and is likely not monophyletic; it includes octopuses without an ink sac with two rows of arm suckers. Field identification of members of this genus relies on their smooth skin, double rows of suckers (which are distinct from zig-zag sucker rows of octopus of Graneledone), the comparatively narrow heads and mantles and, in some species, the mantle being lighter in dorsally than ventrally. Although internal examination of specimens is required to identify species, external characters such as coloration, eye size and, in a few species, dramatically enlarged suckers contribute to species identification.
  • OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Total lengths can approach one meter, but typically 50 cm or less.
  • OLU K. SIBUET M., HARMEGNIES F., FOUCHER J.-P. & A. FIALA-MÉDIONI (1996) Mar. Ecol. Progr. Ser. 132: 109-125.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 109 specimens in 4 taxa.
Water temperature and chemistry ranges based on 67 samples.

Environmental ranges
  Depth range (m): 88.5 - 3252.85
  Temperature range (°C): -0.006 - 8.018
  Nitrate (umol/L): 18.047 - 44.846
  Salinity (PPS): 33.401 - 34.979
  Oxygen (ml/l): 0.578 - 6.184
  Phosphate (umol/l): 1.175 - 3.320
  Silicate (umol/l): 15.017 - 181.171

Graphical representation

Depth range (m): 88.5 - 3252.85

Temperature range (°C): -0.006 - 8.018

Nitrate (umol/L): 18.047 - 44.846

Salinity (PPS): 33.401 - 34.979

Oxygen (ml/l): 0.578 - 6.184

Phosphate (umol/l): 1.175 - 3.320

Silicate (umol/l): 15.017 - 181.171
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Benthoctopus sp. B.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Benthoctopus sp. A.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Benthoctopus cf. rigbyae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Benthoctopus sp.

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 18
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Benthoctopus sp. 1

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Benthoctopus sp. B

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 0
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Benthoctopus sp. CYV-2001

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACATTATATTTTATTTTTGGAATTTGATCAGGTCTACTAGGTACATCACTAAGATTAATAATTCGAACAGAACTAGGACAACCTGGATCTTTATTAAATGAT---GATCAACTCTATAACGTCATTGTTACTGCCCACGCTTTTGTAATAATTTTCTTTTTAGTTATACCCGTAATAATTGGAGGATTTGGAAACTGATTAGTTCCCTTAATATTGGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTACTTCCCCCATCTTTAACCCTCCTCTTAACCTCAGCAGCAGTAGAAAGAGGAGCAGGAACAGGTTGAACTGTTTATCCTCCATTATCTAGAAATTTAGCTCATATAGGCCCATCTGTAGATCTAGCAATTTTTTCTCTTCACTTAGCAGGTATTTCCTCTATTTTAGGAGCCATTAATTTTATCACAACTATCATTAATATACGATGAGAAGGAATACAAATAGAACGTCTTCCTTTATTTGTATGATCAGTTCTAATCACAGCAATCCTACTTCTATTATCATTACCAGTATTAGCAGGTGCAATCACCATACTTCTCACTGACCGTAATTTCAACACAACTTTTTTTGATCCTAGAGGAGGAGGAGATCCTATTCTATACCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Benthoctopus sp. CYV-2001

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                        
Specimen Records:63Public Records:1
Specimens with Sequences:57Public Species:1
Specimens with Barcodes:57Public BINs:1
Species:11         
Species With Barcodes:10         
          
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Locations of barcode samples

Collection Sites: world map showing specimen collection locations for Benthoctopus

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Universidade do Minho
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at Universidade do Minho
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Benthoctopus

Benthoctopus is a genus of octopuses comprising around 25 species. It is thus the most species-rich genus of the deep-sea subfamily Bathypolypodinae. They seem to occur worldwide, and most specimens have been brought up from depths of 200-3,000 m.[1]

Contents

Species

Unidentified Benthoctopus species and orange-stalked crinoid on the Davidson Seamount at 2,422 m depth
Benthoctopus sp. on DSV Alvin's port manipulator arm

New species are being described at a rate of approximately 1–2 per year on average.

Footnotes

  1. ^ a b c d e f g h Ibáñez et al. (2006)
  2. ^ Michael Vecchione, Louise Allcock, Uwe Piatkowski, Jan Strugnell (2009). "Benthoctopus rigbyae, n. sp., a new species of cephalopod (Octopoda; Incirrata) from near the Antarctic Peninsula". Malacologia 15 (1): 13–28. doi:10.4002/040.051.0102. 

References

  • Ibáñez, Christian M.; Sepúlveda, Roger D. & Chong, Javier (2006): A new species of Benthoctopus Grimpe, 1921 (Cephalopoda: Octopodidae) from the southeastern Pacific Ocean. Proceedings of the Biological Society of Washington 119(3): 355–364. DOI: 10.2988/0006-324X(2006)119[355:ANSOBG]2.0.CO;2 HTML abstract
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!