Overview

Comprehensive Description

Description

The largest sea squirt in the British Isles. The test is thick and cartilaginous, pale grey in colour and covered with low raised bumps and ridges. The overall shape is conical, with a broad base and a tall, tapering oral siphon. 120mm tall x 80mm broad. Very distinctive; size, shape and colour separate this species from all other British ascidians.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Confined to warm, sheltered sites in the extreme south of the British Isles. Common in Portland Harbour, Dorset, and known from Bantry Bay, SW Ireland. Common in rias in NW Spain and in the Mediterranean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 5.25 - 15.5

Graphical representation

Depth range (m): 5.25 - 15.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Usually found in places with little water movement, attached to hard substrates.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phallusia mammilata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGCGTCGTTGGTTGATGTCCACTAACCATAAAGATATTGGAACCCTTTACTTCTTATTTGGTATTTTTGCGGGAGTAGTAGGTACGGCAATAAGCGTTATTATTCGCCTCGAGCTATCTCAGTCTGGACTGGTGATCGGGGATGGTCAAGTCTACAATGTGATCGTAACCGCCCATGCCTTTGTGATAATCTTCTTTTTCGTCATGCCCATTATAATCGGCGGGTTTGGTAATTGGCTTTTGCCTATGATAGTGGGGGCGCCTGACATGGCATTCCCCCGTCTTAATAATATGAGCTTCTGGCTACTTCCTCCGGCTTTATTTCTTCTACTAGTCTCTTCCGTGGTTGGGAGTGGGGCCAGAACAGGTTGGACTGTGTACCCCCCTCTTGCTGGCAATTTAGCTCATGCGGGTGCCTCCGTGGATTGTGCTATTTTTTCCCTCCACTTAGCGGGGGTTTCCAGTATTCTCGGGTCGATTAATTTTCTTGTAACGATGATGAACATAAAGGCTAAGGGGTTTGGGGCCTATAATATTAGTCTTTTTTGTTGGTCGGTAATTTTTACAACGATTTTGCTTGTGCTGTCTCTTCCCGTTCTCGCGGCAGCTATCACAATGCTTCTATTTGATCGTAACGCCAATAGTAGCTTCTTTGATCCGGGAGGTGGGGGTGATCCTATTCTGTATCAGCACTTATTTTGGTTTTTTAGGCACCCCGAGGTCTATATTCTGATTCTGCCAGGTTTTGGTATAATCAGCCATGTGGTAGTTTTCTACTCAGGGAAATCCTCTATTTTTGGATATTACGGTATGGTGTGGGCTATGGGAAGCATTGGGCTTTTGGGATTTTTAGTCTGGGCTCATCACATGTTTACGGTGGGTGTGGACGTGGATGCTCGTGCCTATTTTACTGCGGCCACAATAGTGATCGCAGTCCCAACTGGGGTAAAGGTTTTCTCTTGGTTGGGCACCCTTGTGGGTGGTCGCATTCACATGGGGTTAGCTCTTTACTGAGCCTTTGGATTTTTATTCCTATTTACCGTGGGGGGTTTAACTAGGATTGCATTAGCAAACTGCAGCCTAGACTTAGTCTTACACGATACGTACTACGTTGTAGCCCACTTCCACTACGTTCTTTCAATGGGGGCAGTTTTTGCAATTATAGCAAGGTTCTACCATTGGTACCCCCTCTTCACGGGTTTGAGCTTTAATTATACCCTAAGGCTAGCTCATTTCTTTATTATATTTATTGGGGTTAACGTTACTTTTTTCCCACAGCACTTCCTGGGGCTTATGGGTATGCCTCGACGTTATACAGACTACCCAGACTTCTACTACAGGTGAAATCTTATATCGTCCTACAGATCCTCTCTAAGTGCTTTTAGAGTAGTTGTTTTGTTTATAGTGATTTGGGAGTCAATATACTCGCAAAAACCCATATACGCAGTAGAAAGGGGAAGGTTGGAGTGATCTCTTGGGTTGCCCCCCTCTTCTCACACGTGGATTGAGTCTCCCTATATAGGGAGTTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phallusia mammilata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!