Overview

Comprehensive Description

Type Material

Types: Museum of Zoology, University of Bergen, Bergen, Norway, ZMUB 1671 (Cutler and Cutler, 1985).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Description

This species is a small, semi-transparent worm, from cold and deep water. The main distinguishing external character is the posterior glans region that is marked off from the trunk by a ridge.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Most records are from the North Atlantic, from the equator to 57ºN, but there are scattered records from Red Sea, Mediterranean, Indian, and western Pacific Ocean (Cutler, 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

(From Stephen and Edmonds, 1972; Cutler, 1994)

External anatomy

Introvert shorter than the trunk (about a quarter as long as the body). Conical papillae cover the surface.

Trunk is cylindrical, up to100 mm in length, and transparent. The surface of the trunk is divided into a large number of small rectangles by the intersection of the longitudinal and circular muscles.

Glans region (a smooth posterior tip) usually marked off from the trunk by a ridge, and may or may not be interrupted ventrally by a furrow.

Tentacular crown is divided into 8 to 12 lappets or lobes.

Internal anatomy

20-24 longitudinal muscles bands (LMBs), commonly 21-22.

A pair of short and free nephridia.

Brain is elongated, flattened. The lobes are not prominent, and the processes are not developed.

Ventral retractor muscles originate in LMBs 3 and 4, and dorsal retractor muscles from LMBs 8 and 9.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

This is a small species, usually less than 100 mm in length (Cutler and Cutler, 1985).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

shelf to abyssal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

This species is from deep and cold water from sublittoral and bathyal waters, 100-3000 m (Cutler, 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 90 specimens in 1 taxon.
Water temperature and chemistry ranges based on 76 samples.

Environmental ranges
  Depth range (m): 17 - 3494
  Temperature range (°C): 2.457 - 24.203
  Nitrate (umol/L): 0.501 - 44.047
  Salinity (PPS): 34.576 - 36.311
  Oxygen (ml/l): 1.994 - 6.717
  Phosphate (umol/l): 0.100 - 2.014
  Silicate (umol/l): 0.805 - 119.457

Graphical representation

Depth range (m): 17 - 3494

Temperature range (°C): 2.457 - 24.203

Nitrate (umol/L): 0.501 - 44.047

Salinity (PPS): 34.576 - 36.311

Oxygen (ml/l): 1.994 - 6.717

Phosphate (umol/l): 0.100 - 2.014

Silicate (umol/l): 0.805 - 119.457
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sipunculus norvegicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATACTTCATCTTAGGAGTTTGATCTGGCCTTCTAGGCACCTCAATAAGCCTACTAATCCGGGCCGAACTAGGGCAGCCTGGAGCCCTCCTCGGTAGGGACCACCTATACAACGTACTTGTAACGGCACACGCATTTATTATAATCTTTTTTCTAGTAATGCCTGTACTAATCGGCGGGTTCGGAAACTGGCTCATCCCCCTCATACTGGGTAGACCCGACATGGCCTTTCCCCGCCTCAACAATATAAGCTTCTGACTACTTCCCCCCGCTCTTACCCTCCTAGTAGCCTCCGCAGCGGTAGAAAAGGGGGTGGGAGCCGGATGAACTGTATACCCTCCGCTCGCCGGGCCAATTGCACACGCAGGCCCCTCCGTCGACTTAGCAATCTTCTCCCTCCACCTAGCGGGTGCGAGCTCAATTCTTGGAGCACTCAACTTTATTACTACCATCATAAATATACGAGGGAAAGGGTACCAAATAGAACGACTTCCCTTATTCCTATGGGCCGTATTCATTACCGTCATCATACTACTCCTGGCCCTCCCAGTCCTTGCCGGAGCAATTACTATGCTTCTCACGGACCGGAACCTCAACACCTCCTTCTTTGACCCTACAGGAGGCGGAGACCCGATCCTATTCAGCCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sipunculus norvegicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!