Physical Description

Type Information

Paratype for Phascolosoma turnerae Rice, 1985
Catalog Number: USNM 96690
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol); Slide
Collector(s): University of Miami
Year Collected: 1964
Locality: Straits Of Florida, S Of Key West, Florida, United States, North Atlantic Ocean
Depth (m): 1134 to 1183
Vessel: Gerda R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Phascolosoma turnerae Rice, 1985
Catalog Number: USNM 96689
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): University of Miami
Year Collected: 1964
Locality: Straits Of Florida, S Of Key West, Florida, United States, North Atlantic Ocean
Depth (m): 1134 to 1183
Vessel: Gerda R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Phascolosoma turnerae Rice, 1985
Catalog Number: USNM 96688
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): University of Miami
Year Collected: 1964
Locality: Straits Of Florida, S Of Key West, Florida, United States, North Atlantic Ocean
Depth (m): 1134 to 1183
Vessel: Gerda R/V
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Phascolosoma turnerae Rice, 1985
Catalog Number: USNM 96687
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): University of Miami
Year Collected: 1964
Locality: Straits Of Florida, S Of Key West, Florida, United States, North Atlantic Ocean
Depth (m): 1134 to 1183
Vessel: Gerda R/V
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

bathyal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 633.5 - 1158.5

Graphical representation

Depth range (m): 633.5 - 1158.5
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascolosoma turnerae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATACTTTATTTTAGGCATTTGATCCGGCCTAATTGGAACTTCTATAAGCCTCTTAATTCGAGCAGAACTTGGGCAACCAGGCTCTCTTTTAGGCAGAGACCATCTTTACAATGTTATTGTTACAGCTCACGCCTTCTTAATGATTTTCTTTCTCGTAATACCTGTTCTTATTGGAGGCTTTGGTAATTGACTTCTACCATTAATACTAGGAGCTCCGGATATATCCTTCCCACGATTAAACAACATAAGCTTTTGATTACTTCCCCCGGCCCTTATTTTACTAGTTGCATCTGCAGCAGTAGAAAAAGGGGCCGGGACAGGATGAACAGTTTACCCCCCGCTAGCAAACGCAGTGGCCCATGCTGGTCCTTCCGTAGATATAGCAATTTTCTCCCTTCATCTCGCAGGAGTAAGATCTATTCTTGCATCCCTTAACTTTATCACAACAGTTTATAATATGCGCGGTAATGGATTTTGACTCTTCCGAATTCCCCTTTTTGTTATTGCTGTAGTTTTAACAACGATTTTATTACTTCTTGCCCTACCAGTTCTAGCAGGAGCTATTACAATACTTCTAACAGACCGAAACCTTAATACTTGCTTCTTTGACCCTACTGGCGGAGGAGACCCTATTCTTTTTAGTCATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phascolosoma turnerae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!