Ecology

Habitat

intertidal to shelf
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 24 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 0.2 - 5220
  Temperature range (°C): 0.672 - 28.006
  Nitrate (umol/L): 0.009 - 32.364
  Salinity (PPS): 34.563 - 35.618
  Oxygen (ml/l): 3.350 - 5.423
  Phosphate (umol/l): 0.115 - 2.178
  Silicate (umol/l): 1.403 - 113.759

Graphical representation

Depth range (m): 0.2 - 5220

Temperature range (°C): 0.672 - 28.006

Nitrate (umol/L): 0.009 - 32.364

Salinity (PPS): 34.563 - 35.618

Oxygen (ml/l): 3.350 - 5.423

Phosphate (umol/l): 0.115 - 2.178

Silicate (umol/l): 1.403 - 113.759
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascolosoma scolops

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTACTTTATTTTNGGAGTTTGAGCCGGACTTCNNGGNACATCAATAAGACTTCTTATCCGTGCAGAACTCGGACAACCTGGATCTCTCCTGGGCAGAGACCACTTATATAATGTAATTGTAACAGCCCATGCTTTTCTTATAATTTTCTTCCTAGTTATACCAGTCCTAATTGGAGGATTTGGTAATTGACTCTTACCCCTTATACTAGGGGCCCCAGATATAGCCTTTCCTCGACTCAATAACATAAGATTCTGACTTCTTCCTCCAGCTCTAATCCTACTTGTAGGATCCGCCGCAGTAGAAAAAGGGGCAGGAACAGGATGAACAGTTTATCCTCCTTTAGCTAACGCCATCGCCCATGCAGGCCCCTCTGTTGATTTAGCCATTTTCTCTCTTCATCTCGCAGGAGTAAGGTCTATCTTAGCTTCACTAAACTTCATTACCACAGTGTACAATATACGAGGTAAAGGGTTCTGAATATTCCGAGTTCCTCTCTTCGTATGAGCAGTTATATTGACTACCATTCTTCTCCTTCTAGCCCTCCCAGTGCTCGCAGGGGCAATCACTATACTCCTTACGGATCGAAATCTTAACACCTGCTTCTTTGACCCTACAGGAGGCGGAGACCCTGTCCTATTTAGCCATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phascolosoma scolops

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!