Ecology

Habitat

coastal
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 86 specimens in 1 taxon.
Water temperature and chemistry ranges based on 55 samples.

Environmental ranges
  Depth range (m): 0 - 200
  Temperature range (°C): 6.506 - 17.140
  Nitrate (umol/L): 0.211 - 7.641
  Salinity (PPS): 35.024 - 39.033
  Oxygen (ml/l): 5.190 - 6.173
  Phosphate (umol/l): 0.095 - 0.671
  Silicate (umol/l): 1.247 - 4.080

Graphical representation

Depth range (m): 0 - 200

Temperature range (°C): 6.506 - 17.140

Nitrate (umol/L): 0.211 - 7.641

Salinity (PPS): 35.024 - 39.033

Oxygen (ml/l): 5.190 - 6.173

Phosphate (umol/l): 0.095 - 0.671

Silicate (umol/l): 1.247 - 4.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascolosoma granulatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATTTTATCCTAGGAATTTGATCAGGCCTCATAGGAACGTCAATAAGCCTGCTTATTCGAGCTGAATTAGGGCAGCCTGGCTCTCTATTAGGAAGAGATCAACTATATAATGTAATTGTTACCGCTCATGCTTTTTTAATAATTTTTTTCCTAGTTATACCGGTACTAATCGGAGGATTTGGAAACTGACTAATTCCATTAATAATTGGAGCACCAGATATAGCCTTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTCCAGCACTTTGTCTTCTTCTAGCTTCAAGAGCAGTAGAAAAAGGAGTAGGAACTGGATGAACAGTATACCCGCCTCTATCCGGAGCCCTCGCACATGCAGGCCCATCCGTCGATCTGGCCATCTTCTCTCTTCACTTAGCAGGAGTAAGATCTATCTTAGGCGCATTAAACTTTATTTCTACAGTAGCTAATATACGCCCAAGAATACTTTCCTGAGAACGCATTCCATTATTTGTATGAGCAGCTTTTATTACAGTAGTTCTTTTATTACTTGCACTGCCCGTTCTAGCAGGTGCTATCACAATACTTCTAACAGATCGAAATTTAAACACAGCTTTCTTTGATCCTGGAGGTGGAGGAGATCCTATTCTATTTAGTCATCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phascolosoma granulatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!