Overview
Distribution
East North Atlantic, European waters (ERMS scope), Irish Exclusive economic Zone, Mediterranean Sea, Portuguese Exclusive Economic Zone, Shetlands, Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
-
Hayward, P.J.; Ryland, J.S. (Ed.) (1990). The marine fauna of the British Isles and North-West Europe: 1. Introduction and protozoans to arthropods. Clarendon Press: Oxford, UK. ISBN 0-19-857356-1. 627 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1
-
van der Land, J. (2001). Sipuncula, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 178-179
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1430
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Ramos, M. (ed.). 2010. IBERFAUNA. The Iberian Fauna Databank
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=149024
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Ecology
Habitat
coastal
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Depth range based on 86 specimens in 1 taxon.
Water temperature and chemistry ranges based on 55 samples.
Environmental ranges
Depth range (m): 0 - 200
Temperature range (°C): 6.506 - 17.140
Nitrate (umol/L): 0.211 - 7.641
Salinity (PPS): 35.024 - 39.033
Oxygen (ml/l): 5.190 - 6.173
Phosphate (umol/l): 0.095 - 0.671
Silicate (umol/l): 1.247 - 4.080
Graphical representation
Depth range (m): 0 - 200
Temperature range (°C): 6.506 - 17.140
Nitrate (umol/L): 0.211 - 7.641
Salinity (PPS): 35.024 - 39.033
Oxygen (ml/l): 5.190 - 6.173
Phosphate (umol/l): 0.095 - 0.671
Silicate (umol/l): 1.247 - 4.080
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 55 samples.
Environmental ranges
Depth range (m): 0 - 200
Temperature range (°C): 6.506 - 17.140
Nitrate (umol/L): 0.211 - 7.641
Salinity (PPS): 35.024 - 39.033
Oxygen (ml/l): 5.190 - 6.173
Phosphate (umol/l): 0.095 - 0.671
Silicate (umol/l): 1.247 - 4.080
Graphical representation
Depth range (m): 0 - 200
Temperature range (°C): 6.506 - 17.140
Nitrate (umol/L): 0.211 - 7.641
Salinity (PPS): 35.024 - 39.033
Oxygen (ml/l): 5.190 - 6.173
Phosphate (umol/l): 0.095 - 0.671
Silicate (umol/l): 1.247 - 4.080
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Phascolosoma granulatum
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTATTTTATCCTAGGAATTTGATCAGGCCTCATAGGAACGTCAATAAGCCTGCTTATTCGAGCTGAATTAGGGCAGCCTGGCTCTCTATTAGGAAGAGATCAACTATATAATGTAATTGTTACCGCTCATGCTTTTTTAATAATTTTTTTCCTAGTTATACCGGTACTAATCGGAGGATTTGGAAACTGACTAATTCCATTAATAATTGGAGCACCAGATATAGCCTTTCCACGATTAAATAACTTAAGATTTTGACTTTTACCTCCAGCACTTTGTCTTCTTCTAGCTTCAAGAGCAGTAGAAAAAGGAGTAGGAACTGGATGAACAGTATACCCGCCTCTATCCGGAGCCCTCGCACATGCAGGCCCATCCGTCGATCTGGCCATCTTCTCTCTTCACTTAGCAGGAGTAAGATCTATCTTAGGCGCATTAAACTTTATTTCTACAGTAGCTAATATACGCCCAAGAATACTTTCCTGAGAACGCATTCCATTATTTGTATGAGCAGCTTTTATTACAGTAGTTCTTTTATTACTTGCACTGCCCGTTCTAGCAGGTGCTATCACAATACTTCTAACAGATCGAAATTTAAACACAGCTTTCTTTGATCCTGGAGGTGGAGGAGATCCTATTCTATTTAGTCATCTC
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Phascolosoma granulatum
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
