Overview

Comprehensive Description

Biology/Natural History: Length (with introvert extended) to 12 cm. This is the most common sipunculan in California. In the San Juan Islands it breeds from June to September. When gravid, gametes may make up to 37% of animal's mass. The eggs are yellow or orange, flattened and beanlike and surrounded by a thick envelope. The planktotrophic larva spends a long time in the plankton. This species has cerebral eyes which are similar to those of flatworms, annelids, and mollusks. This species uses its 18-24 short, simple tentacles around the mouth to collect detritus from the surface of the sediment, then inverts the introvert and swallows the detritus. Black Oystercatchers are said to eat this species on Vancouver Island.

Members of Genus Phascolosoma have their longitudinal muscles in 4 bands rather than in a continuous column around the body as seen in most other Sipunculans. These bands can sometimes be seen externally. Sipunculan coelomic fluid contains unusual motile, multicellular structures called urns. The urns gather metabolic and particulate wastes, produce mucus in response to infection, and help the blood to clot after an injury. The urns can easily be seen in the coelomic fluid under a microscope. Sipunculans such as Phascolosoma have separate sexes. Their eggs or sperm are produced from cells in the peritoneum surrounding the coelom rather than in distinct gonads. They mature in the coelomic space and then are shed out the nephridia (kidneys). Males spawn first, which seems to trigger females to spawn. The fertilized egg develops into a trochophore larva (similar to polychaetes and mollusks) which feeds off internal food, then (in Phascolosoma) elongates and becomes a pelagosphera larva which feeds. The pelagosphera eventually elongates more, settles, and grows up into a juvenile then adult.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This sipunculan has inconspicuous, fingerlike, unbranched filiform tentacles (at the anterior end of the introvert). The introvert (extensible anterior end) has dark blotches and transverse streaks, with 15-25 rings of small hooks near its anterior end. Trunk color is pale sepia or tan to dark brown, often with brown or purplish spots. Skin is rough due to conical papillae that are largest at the posterior region of the trunk.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographical Range: Kodiak Island, Alaska to Bahia de San Quintin (Baja California). It is also found in the Atlantic and Indian Oceans.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: This is the only local sipunculan with the dark blotches and transverse streaks on its introvert
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 11 specimens in 2 taxa.
Water temperature and chemistry ranges based on 6 samples.

Environmental ranges
  Depth range (m): 1 - 1430
  Temperature range (°C): 3.270 - 14.603
  Nitrate (umol/L): 1.979 - 33.556
  Salinity (PPS): 33.310 - 35.252
  Oxygen (ml/l): 3.123 - 6.095
  Phosphate (umol/l): 0.482 - 2.349
  Silicate (umol/l): 3.503 - 56.582

Graphical representation

Depth range (m): 1 - 1430

Temperature range (°C): 3.270 - 14.603

Nitrate (umol/L): 1.979 - 33.556

Salinity (PPS): 33.310 - 35.252

Oxygen (ml/l): 3.123 - 6.095

Phosphate (umol/l): 0.482 - 2.349

Silicate (umol/l): 3.503 - 56.582
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth Range: Middle to low intertidal, shallow subtidal

Habitat: In gravel under rock, in crevices, in burrows made by boring clams, in roots of surfgrass or kelp holdfasts, mussel beds, among growth on pilings. Open coast and protected water.

Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascolosoma agassizii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTTTATCCTCGGCATTTGATCTGGTCTTATAGGCACTTCCATAAGACTATTAATTCGAGCAGAACTAGGGCAACCTGGATCCCTACTGGGGAGGGACCAACTCTATAATGTCATCGTTACAGCCCATGCGTTTTTAATAATTTTCTTCCTTGTAATACCAGTCTTAATCGGAGGCTTCGGAAACTGGTTAATCCCCCTAATGATTGGAGCTCCTGATATGGCCTTTCCTCGGCTCAATAACCTCAGATTTTGACTTTTGCCTCCGGCCCTCTGCCTTCTCTTAGCATCTAGGGCCATCGAAAAGGGAGTCGGAACAGGATGAACAGTGTACCCCCCTCTTTCTGGTGCACTAGCTCATGCTGGCGCATCTGTAGACCTTGCTATTTTTTCTCTTCACCTTGCAGGTGTAAGCTCTATTCTAGGTGCGCTGAACTTTATCTCTACTGTAACTAACATGCGCCCTAGAATACTCTCATGAGAGCGAACCCCTCTTTTTGTTTGAGCAGCCTTTATTACAGTAGTCCTTCTTCTCCTTGCGCTTCCTGTATTAGCAGGTGCAATTACTATGCTGCTAACTGACCGTAATGTAAATACTGCCTTCTTCGACCCGGGAGGAGGAGGCGACCCCATTTTATTTAGACACTTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phascolosoma agassizii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!