Physical Description

Type Information

Type for Phascolosoma capitatum Gerould
Catalog Number: USNM 4067
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Year Collected: 1883
Locality: Off Martha's Vineyard, Massachusetts, United States, North Atlantic Ocean
Depth (m): 2136 to 2136
Vessel: Albatross R/V
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 12 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 826 - 4200
  Temperature range (°C): 1.990 - 9.983
  Nitrate (umol/L): 16.767 - 26.380
  Salinity (PPS): 34.822 - 36.012
  Oxygen (ml/l): 3.953 - 5.630
  Phosphate (umol/l): 1.056 - 1.821
  Silicate (umol/l): 9.705 - 67.523

Graphical representation

Depth range (m): 826 - 4200

Temperature range (°C): 1.990 - 9.983

Nitrate (umol/L): 16.767 - 26.380

Salinity (PPS): 34.822 - 36.012

Oxygen (ml/l): 3.953 - 5.630

Phosphate (umol/l): 1.056 - 1.821

Silicate (umol/l): 9.705 - 67.523
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascolosoma capitatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATATTTTATCTTAGGCATTTGATCCGGCCTAATGGGCACATCAATAAGACTACTTATTCGTGCAGAATTAGGACAGCCAGGATCACTCTTAGGAAGAGACCAACTATACAATGTCATTGTAACAGCACATGCATTTTTAATAATTTTCTTTCTTGTTATACCAGTTCTAATTGGGGGCTTTGGTAATTGATTAATTCCATTAATAATTGGTGCGCCTGATATAGCGTTTCCCCGACTAAATAACTTAAGATTTTGACTTTTGCCTCCGGCTCTATGCCTATTACTTGCCTCAAGAGCTACAGAAAAAGGAGTTGGCACTGGTTGAACTGTTTATCCCCCCTTATCAGGAGCTCTCGCTCACGCAGGCCCCTCTGTAGACCTAGCAATTTTTTCCCTTCATCTAGCCGGTGTCAGATCAATTCTGGGCGCCCTAAACTTTATCTCAACAGTAACTAATATGCGCCCAAGCATATTCTCATGAGAACGTATTCCTTTATTTGTGTGGGCCGCATTTATTACAGTAATCCTTCTATTACTAGCGTTGCCCGTCTTAGCCGGCGCAATTACAATACTCCTAACAGACCGAAACCTAAACACAGCCTTTTTTGACCCAGGAGGAGGAGGAGACCCTATTCTATTTAGCCACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phascolosoma capitatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!