Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Comprehensive Description

Type Material

According Cutler & Cutler (1983) the type material is listed in the catalogue of the Museum für Naturkunde der Humboldt Universität, Berlin, under the following numbers: MNHU1011, MNHU1012, and MNHU1013, but the specimens are missing. In their revision of this genus, they looked at MNHU6058 from Barbados and MNHU1015 from St. Croix to redescribe the species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Locality

Costa Rica, Puntarenas, St. Croix (Grübe and Oersted, 1858)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Description

In general, this species is very similar to several Phascolosoma in terms of ecology and morphological characters. However, the digitiform villi of the contractile vessel of Antillesoma distinguish this species from any Phascolosoma. A further distinction is the lack of hooks on the introvert. The introvert is of variable length, but often about equal to that of the trunk. Numerous digitiform tentacles (>30 in adults) are arranged around the nuchal organ. There are 4 retractor muscles, but each lateral pair may be considerably fused, appearing as one muscleon each side of the nerve cord, with a small bifurcation near the origin. The longitudinal muscle layer of the trunk is divided in anastomosing bundles, which are visible through the trunk wall in small specimens. The trunk and the introvert are covered by papillae that are concentrated on the extremities.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

circum-(sub)tropical
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

(From Cutler & Cutler, 1983)

External anatomy

Introvert is 65-75% of the trunk length (living specimens). The posterior introvert bears papillae whereas the anterior part is smooth and white. A white collar separates these two regions. In live specimens from Florida (see pictures) the anterior portion of the introvert is divided into three different color regions. Immediately behind the tentacles is a brown-green pigment band, followed by a white region and a golden band just before the collar.

Tentacular crown has numerous digitiform tentacles (30-200) encircling the nuchal organ. The number of tentacles increases with the size of the specimen and pigmentation occurs as violet (brown when the specimen is preserved) patches or stripes. The pigmentation usually extends onto the area around the nuchal organ. A live specimen from Florida (see pictures) has tentacles with white and brown pigments distributed in stripes encircling a white nuchal organ.

No hooks.

Trunk is pale yellow-brown and has many large dark papillae, especially concentrated around the anterior end. Trunk length commonly 15-30 mm , exceptionally 85 mm , and width equal to 10-25% of the length.

Internal anatomy

Trunk wall with longitudinal muscle layer divided in many anastomosing bands.

Intestinal spiral is attached at the both ends by the spindle muscle.

The contractile vessel has numerous villi along its length, the larger villi branching at their tips.

A small rectal caecum is usually present.

Nephridium opens just posterior to the anus.

Two pairs of retractor muscles originate about 60-70% of the distance to the posterior end of the trunk. The dorsal pair is attached very close to the ventral pair, and normally they separate for only a very short distance, about 10-20% of their length. Sometimes, in specimens with the introvert retracted, the lateral retractor muscles appear to be united as a single pair, each having two large roots.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

intertidal to shelf; in rock
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 2000
  Temperature range (°C): 10.565 - 10.565
  Nitrate (umol/L): 36.078 - 36.078
  Salinity (PPS): 35.013 - 35.013
  Oxygen (ml/l): 0.354 - 0.354
  Phosphate (umol/l): 2.869 - 2.869
  Silicate (umol/l): 48.925 - 48.925

Graphical representation

Depth range (m): 0 - 2000
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

This species is considered a cosmopolitan species widespread in tropical and subtropical waters. It has been reported in the western Atlantic and Caribbean from Florida to Brazil; in the eastern Atlantic from Sierra Leone.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Four miles off Fort Pierce Inlet Antillesoma antillarum is found in coquina rubble with the following sipunculans species: Aspidosiphon albus, A. parvulus, A. fischeri, A. sp., N. rimicola, Themistes lageniformis, Nephasoma pellucidum.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

(From Rice, 1975)

This species follows the developmental pattern IV determined by Rice (1976), which includes a lecithotrophic trochophore and a planktotrophic pelagosphera larva that often remains for several months in the plankton. The cleavage is spiral and unequal. After approximately 3 to 3 ½ days at 25ºC the lecithotrophic trochophore metamorphoses into a planktothrophic pelagosphera larva.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Antillesoma antillarum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGAACATCAATAAGACTCCTAATCCGAGCAGAATTAGGGCAGCCAGGATCTCTTCTAGGCAGAGATCAGCTATACAATGTTATTGTAACCGCTCACGCTTTCCTAATGATTTTCTTTCTTGTCATGCCAGTTCTCATCGGAGGCTTCGGAAATTGATTAATCCCTCTAATAATTGGCGCTCCAGACATAGCCTTCCCCCGATTAAACAATATGAGCTTTTGATTATTGCCTCCGGCCTTATTACTCCTTCTCGCCTCGAGAGCAGTAGAAAAAGGAGTAGGAACAGGATGAACCGTCTACCCCCCTCTTTCCGGCGCCTTAGCTCATGCCGGGGCCTCAGTAGATCTCGCTATTTTCTCTCTCCATCTAGCCGGAGTAAGTTCTATTCTAGGAGCCCTAAATTTTATTTCTACAGTAACTAATATACGCCCCAACAAACTATCTTGAGAGCGAATTCCTTTATTCGTCTGAGCAGCATTCATTACTGTTATTCTTCTATTATTAGCATTACCAGTCCTAGCCGGAGCAATCACCATACTCTTAACAGACCGGAATCTAAACACGGCCTTCTTTGATCC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Antillesoma antillarum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Antillesoma antillarum

Antillesoma antillarum is the only species of peanut worms (Sipuncula) of the genus Antillesoma. The genus belongs to the family Phascolosomatidae.[1]

Synonymy[edit]

Distribution[edit]

This species is considered a cosmopolitan species. They are widespread in tropical and subtropical waters. It has been reported in the western Atlantic and the Caribbean from Florida to Brazil, in the eastern Atlantic in Sierra Leone.[2][3]

Habitat[edit]

Antillesoma antillarum has been found inhabiting mollusc shell middens. They accompany and associate with the following species of sipunculids: Aspidosiphon albus, A. Parvulus, A. fischeri, Temistes lageniformis, y Nephasoma pellucidum.[3]

References[edit]

  1. ^ World Register of Marine Especies (WoRMS): Antillesoma antillarum (Grube, 1858) AphiaID: 136075 [1]
  2. ^ Cutler, Edward B. (1994): The Sipuncula: their systematic, biology and evolution. Comstock Publishing Associates of Cornell University. Ithaca, New York. 406p ISBN 0-8014-2843-2 [2]
  3. ^ a b Sipuncula LifeDesk. [3]

Other website[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!