Overview

Comprehensive Description

Type Material

Holotype: USNM 39003

Paratype: USNM 39004

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Locality

Florida, Miami, Virginia Key, Rickenbacker Causeway.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Description

This species is found exclusively in Southeastern United States where it may occur in densities of more than 3,000/square meter (Rice et al, 1983). External characters distinguishing this species from other Phascolion are the unique tentacular crown with four primary tentacles, the array of auxiliary tentacles, an absence of hooks on the anterior part of the introvert, and the V-shaped holdfast papillae. It inhabits discarded gastropod shells and is commonly found in shallow waters associated with sea grass beds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

This species is found only in Southeastern United States, commonly in shallow waters. Cutler and Cutler (1985) in the revision of the genus report a few examples from off Cape Lookout, North Carolina in deeper water (100 m depth).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

(From Hendrix, 1975)

External anatomy

The tentacular crown is formed by four primary tentacles. Usually the dorsal pair is bifid and ventral pair is trifid; in the expanded anterior introvert of live specimens the tentacles appear in the shape of an “X”.

The nuchal organ is posterior to the dorsal pair of tentacles and is often obscured by them. It is cushion-shaped and divided longitudinally into pleats. In the living specimen the pleats are white and the grooves are pink or red.

The introvert can be twice the length of the trunk. The anterior end of the introvert, just behind the nuchal organ, has a very thin wall. The internal coelomic pressure expands this region forming the introvert bulb. Encircling this bulb there are as many as seven rings of auxiliary tentacles. They are stubby outpouchings of the introvert wall. Auxiliary tentacles of the first and the last rings are simple, but the tentacles from the middle rings could have two or three lobes. The collar is a thin rim of epithelium encircling the most posterior portion of the introvert bulb, which delineates the bulb from the rest of the introvert.

A region of close-set papillae begins behind the collar and continues posteriorly along the introvert onto the anterior part of the trunk. The papillae are flask-shaped and gradually increase in size from the collar (42 µm high) to the anterior part of the trunk (84 µm high). It is common to find sediment and chalky material embedded between the tallest papillae, obscuring all but their tips. The papillae begin to decrease in size in the anterior 1/3 of the trunk.

Holdfast papillae, chitinous and shaped like an arrowhead, are present in the middle of the trunk. There is a small, blunt, posteriorly directed point at the anterior apex of the holdfast papilla and posterior to the point there is a pore. The holdfast papillae are dark brown and their concentration in the middle of the trunk creates a dark zone. They are abundant and best developed where the sipunculan’s trunk wraps around the columella of the gastropod shell. The size of the holdfast papillae varies but in general they are large (42 µm high to 700 µm wide). The number of holdfast papillae decreases posteriorly.

Internal anatomy

There is only one dorsal retractor muscle, which attaches to extreme posterior end of the trunk.

The gut has only 2 loops; the first one is smaller and is anchored to the trunk wall by three fastening muscles (thin muscles, easy to overlook or to be cut in the process of dissecting the specimen). The second loop is longer, extending to the posterior of the coelom, and anchored to the trunk wall by four fastening muscles. These loops often become twisted to give the appearance of coiling.

Only the right nephridium is present. It is attached anteriorly to the trunk wall by mesentery and posteriorly by a fastening muscle.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Specimens average 3 cm in extended length (Rice et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Look Alikes

Similar Species

When the introvert is withdrawn, this species appears similar to Phascolion strombus. The observation of the tip of the introvert and the retractor muscle is essential for identification. The holdfast papillae are similar to P. strombus but in P. cryptum these papillae occur more posteriorly on the trunk.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

coastal to shelf
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

(From Hendrix, 1975)

Phascolion cryptum inhabits discarded gastropod shells. This species at the type locality occurs in shallow water along with the sea grass Diplanthera wrightii, the gastropods Batellaria minima, Nassarius vibex, and Prunum apicinum, bilvalves Anodontia alba and Codakia orbiculari, and the polychaetes Arenicola cristata, Chaetopterus variopedatusi, and Onuphis magna. The low tide exposes this faunal zone twice daily and it is subject to seasonal extremes of temperature and salinity. Phascolion cryptum bury themselves up to a depth of 5 cm during the period of low tide and emerge on or near the surface during the period of high tide. The grain size of the sediment in this habitat ranges from 0.2-0.3 mm.

Rice et al. (1983) conducted a monthly study for one year during which they reported a density of 667 to 3,856/m2 at 9.25 km north of the Fort Pierce Inlet (Link Port site), Florida. It was considered by them to be the highest densities recorded up to the time of that study for any sipunculan species. In this area P. cryptum is commonly found in five different species of gastropod shells (Cerithium muscarum, Nassarium vibex, Nerita virginea, Modulus modulus, and Marginella apicina). The study suggested that P. cryptum could display some degree of selectivity for different species of shells. Juvenile specimens were found in smaller shells and adults in larger shells, indicating that P. cryptum changes shells at it grows (Rice et al., 1983). But exchange of shells or specimens without shells was not observed in the field. Predation on this species has been demonstrated in laboratory (Nelson, 1981). This author suggested that two species of decapod shrimp might be predators of P. cryptum.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 4

Graphical representation

Depth range (m): 1 - 4
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

According to Hendrix (1975) spawning occurs throughout the year in the vicinity of Miami, Florida, but there is a greater maturation of individuals during the mid-summer. Rice et al. (1983) observed that reproduction in the Indian River Lagoon trends toward increased activity from November through May. This species follows the developmental pattern I determined by Rice (1975, 1976), in which development is direct, lacking a larval stage. The egg of P. cryptum averages 136 µm in diameter and is white with a dense concentration of yolk (Rice, 1975). Surrounded by a thin layer of adhesive jelly coat, the eggs are adhesive and attach to the substratum contacted at the time of the spawning . Cleavage is spiral and unequal. Within 36 to 38 hours after fertilization a small worm hatches from the jelly coat (Rice, 1975).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phascolion cryptum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTATTTAATGTTTGGGATGTGGTGTGGTATAGTTGGAACTGGACTTAGAATGATTATTCGTATGGAGTTGGGTCAACCAGGATCTCTTTTAGGAAATGATCATTTATATAATACTATTGTAACGGCCCATGCTTTCATTATACTTTTTTTTCTTGTTATACCTATTTTAATTGGGGGGTTTGGTAATTGGCTGGTTCCTTTAATATTAGGGGTGCCTGATATAGCTTTTCCTCGTTTAAATAATATAAGATTTTGATTACTTATTCCATCTATTCTTATGTTAGTGGAAAGTATAGGTATTGGGCGTGGAGTAGGAACAGGTTGGACTGTTTATCCTCCTCTTGCTAGCGTTAAATATCATGGTGGGCCTAGGGTGGATTTTGGGATTTTTTCTTTACATTTGGCTGGGGCCAGATCTATTTTAGGAGCGATTAATTTTATTACTACTATTCTTGTTATGCGTGCTCGTGATTATAAAATTTGGCGGGCGCCTTTATTTGTTTGATCAATTCTTGTAACTGCTGTATTATTGTTGACTTCTCTTCCTGTTTTTGCAGGGGCTATTACAATGCTTTTGTTCGATCGTAATTTTAATAGAAGGTTTTTTGATCCTGCTGGGGGTGGTGACCCTATTCTTTTTAGACATTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phascolion cryptum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!