Overview

Comprehensive Description

Taxonomic Remarks

This species was first described by Gibbs (1973) from southwestern England based on a collection of more than 200 specimens.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Material

(From Gibbs, 1973)

A large specimen with 65 mm long is deposited in the British Museum (Natural History) under the registration number 1972.9.1. A series of 25 paratypes specimens, measuring 15-65 mm in length, are deposited in the same Museum under registration number 1972.9.2-26. Additional material has been deposited in the collection of the National Museum of Ireland, Dublin, and the Zoological Museum of the University of Bergen.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Locality

West Reef, Wembury (Gibbs, 1973).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Description

This species is the only one in the genus with hooks arranged in several rings. The trunk has smooth and lustrous skin without prominent papillae. The oral disk has a circle of flattened tentacles surrounding the mouth, and a lobed nuchal organ. The transition from introvert to trunk is not sharply marked and the introvert tapers gradually towards its tip. A pair of nephridiopores opens anteriorly to the anus.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Nephasoma rimicola, like all sipunculid worms, has an unsegmented body consisting of an introvert and a trunk. The introvert can be withdrawn into the trunk. The mouth, which is on the end of the introvert, is surrounded by up to 16 tentacles. Nephasoma rimicola, has a trunk at least three times as long as it is wide, about the same length of the introvert. The introvert is covered by many spine-like hooks at the anterior end. The body may reach up to 6 cm in length and colouration is extremely variable. Nephasoma rimicola has well formed oral tentacles and the introvert hooks are arranged in rings.Unlike Nephasoma minutum, Nephasoma rimicola has well formed oral tentacles and the introvert hooks are arranged in rings (Cutler, 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

This species was found in intertidal waters in southwestern England, northern Spain, and the southern coast of Florida. Off southern Spain it was collected in deep water (350-720 m).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

External anatomy

(From Gibbs, 1973)

Introvert shorter than the trunk. Transition from introvert to trunk is not sharply marked and the introvert tapers gradually towards its tip.

Hooks arranged in rings. The anterior rings are normally complete but the posterior ones often have many hooks missing. The largest hook measured 75 µm height.

The trunk is 1.5-3.0 mm in width, slender and cylindrical.

Tentacular crown consists of a single circle of slender, flattened tentacles around the mouth. The tentacles are grouped in pairs and arranged. In worms longer than 20 mm, the number of tentacles varies from 12-20, but normally there are 16.

The nuchal organ is divided by shallow longitudinal grooves into five main lobes.

Internal anatomy

The trunk wall has a continuous longitudinal muscle.

Two ventral retractor muscles are attached to the body wall in the anterior half of the body. In extended worms the point of attachment lies between two-fifths and halfway along the length of the body, and about one-fifth of the distance between the anus, and the posterior end of the trunk.

Spindle muscle extends through the intestinal coil and is not attached to the posterior end.

There are no fixing muscles attaching the gut to the trunk wall.

A small caecum is present on the rectum.

A pair of free nephridia opens posterior to the anus.

A pair of reddish eyespots is embedded in the brain, and they are visible through the introvert wall.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

The majority of the worms measure 25-50 mm in total length (introvert extended), and the largest are 65 mm long (Gibbs, 1973).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Skin smooth without prominent papillae. Hooks arranged in rings behind the tentacles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Similar Species

The array of hooks, the distinct tentacles and the nephridiopores posterior to the anus differentiate N. rimicola from its congener species N. minutum.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

intertidal to upper slope
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

In southwestern England and northern Spain this species was found in muddy sand with fine shell gravel filling rock crevices (Gibbs, 1973 and Saiz Salinas, 1986). In deep water off southern Spain it was found in sediment composed of mollusk shells, foraminiferans or pteropods (Saiz Salinas, 1990). In Florida the specimens were found in coquina rubble.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 352 - 718
  Temperature range (°C): 11.590 - 13.205
  Nitrate (umol/L): 5.360 - 16.281
  Salinity (PPS): 35.476 - 38.546
  Oxygen (ml/l): 4.119 - 4.691
  Phosphate (umol/l): 0.263 - 0.893
  Silicate (umol/l): 4.831 - 7.283

Graphical representation

Depth range (m): 352 - 718

Temperature range (°C): 11.590 - 13.205

Nitrate (umol/L): 5.360 - 16.281

Salinity (PPS): 35.476 - 38.546

Oxygen (ml/l): 4.119 - 4.691

Phosphate (umol/l): 0.263 - 0.893

Silicate (umol/l): 4.831 - 7.283
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Nephasoma rimicola is a benthic species often on found in lower shore rock crevices.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Four miles off Fort Pierce Inlet, Florida, N. rimicola is found in coquina rubble with the following sipunculans species: Aspidosiphon albus, A. parvulus, A. fisheri, A. sp., Nephasoma pellucidum, Antillesoma antillarum.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nephasoma rimicola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTCTGATCAGGGCTTCTAGGTGCATCAATAAGATTATTAATTCTAACAGAATTAGGTCAACCAGGATCATTATTAGGCAAT---GATCATTTATATAACGTTATTGTAACTGCTCACGCATTTTTAATAATCTTCTTTCTTGTTATACCTGTATTAATTGGGGGATTTGGCAACTGACTATTACCTCTAATAATAAGGGCACCAGACATAGCTTTCCCGCGTTTAAATAACATAAGCTTCTGATTACTTCCCCCTGCCCTTTTATTACTTGTAGCCTCTGCAGCAGTAGAGAAAGGTGTTGGAACAGGATGAACAGTATATCCCCCATTATCAGACGCAATCGCACATTCAGGTCCCTCTGTAGATTTAGCTATTTTCTCCTTACATTTAGCAGGAGTAAGCTCCATCCTCGCATCCTTAAACTTTATTACAACTGTGTATAATATACGCGGTAAAGGTTTCTGAATGCTCCGTGTTCCTTTATTTGTTTGAGCTGTAATACTAACAACAATTCTTCTTTTACTAGCTCTACCTGTTTTAGCTGGAGCTATTACAATACTTTTAACTGACTGTAATTTAAATACCTGTTTTTTTGATCCTACAGGAGGAGGAGAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nephasoma rimicola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!