Overview

Comprehensive Description

Description

 Golfingia vulgaris, like all sipunculid worms, has an unsegmented body consisting of an introvert and a trunk. The introvert can be withdrawn into the trunk. The mouth, which is on the end of the introvert, is surrounded by up to 60-150 tentacles in three or more circles. The trunk is at least three times as long as it is wide and is slightly shorter than the introvert. The introvert is covered by many dark brown stumpy hooks at the anterior end. These are arranged irregularly. Golfingia vulgaris may reach up to 20 cm in length. It is very variable in colour, from grey to whitish or yellowish brown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology/Natural History: There are many subspecies of this species, widely distributed. The genus name Golfingia was created by E. Ray Lankester to celebrate a holiday he spent golfing at Saint Andrews in 1885.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The tentacles of this species are unbranched, small and fingerlike, and are arranged in 1-2 circles around the mouth. The introvert does not have dark blotches and streaks nor a row of hooks near its anterior end, and its length is less than half the body length. The skin is very rough and dark brown (photo). Has 4 retractor muscles.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Look Alikes

How to Distinguish from Similar Species: Phascolosoma agasssizi has an introvert with dark streaks and blotches, plus its tentacles are in a crescent dorsal to the mouth. Golfingia pugettensis has smooth, light-colored skin and a longer introvert.
Creative Commons Attribution Non Commercial Share Alike 2.0 (CC BY-NC-SA 2.0)

© Rosario Beach Marine Laboratory

Source: Invertebrates of the Salish Sea

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 353 specimens in 3 taxa.
Water temperature and chemistry ranges based on 131 samples.

Environmental ranges
  Depth range (m): 0 - 1920
  Temperature range (°C): 2.110 - 23.342
  Nitrate (umol/L): 0.267 - 40.639
  Salinity (PPS): 31.893 - 39.006
  Oxygen (ml/l): 2.285 - 7.190
  Phosphate (umol/l): 0.056 - 2.950
  Silicate (umol/l): 1.450 - 151.917

Graphical representation

Depth range (m): 0 - 1920

Temperature range (°C): 2.110 - 23.342

Nitrate (umol/L): 0.267 - 40.639

Salinity (PPS): 31.893 - 39.006

Oxygen (ml/l): 2.285 - 7.190

Phosphate (umol/l): 0.056 - 2.950

Silicate (umol/l): 1.450 - 151.917
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Golfingia vulgaris is a benthic species often found in muddy sand or gravel from the low water mark down to depths of several hundred metres.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Golfingia vulgaris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTACTTTATTTTAGGCATCTGAGCAGGCCTACTAGGAACCTCTATAAGACTTCTAATCCGAGCAGAGCTAGGCCAACCTGGCTCTCTACTAGGCAGAGACCACTTATATAATGTTATTGTGACTGCACATGCTTTTCTTATAATTTTTTTCCTTGTTATACCCGTTCTCATTGGCGGATTTGGTAATTGACTTCTGCCATTAATACTAGGCGCTCCTGATATATCTTTCCCCCGACTAAATAATATAAGGTTTTGGTTACTTCCTCCTGCCCTTATTCTCCTTGTTTCCTCTGCTGCAGTCGAAAAAGGAGCAGGCACTGGTTGAACAGTGTACCCCCCACTAGCAAACGCTATTGCTCACGCTGGTCCGTCAGTAGATCTTGCAATTTTCTCCTTACATTTGGCTGGGGTTAGCTCTATTTTAGCCTCTCTAAACTTCATCACTACCGTTTATAATATACGTGGACAAGGGTTTTGAATGTTCCGAGTGCCTTTATTTGTATGAGCTGTCATATTAACAACAATCCTCCTTCTCCTTGCACTCCCAGTCTTAGCAGGGGCTATTACTATATTACTAACCGACCGCAACCTAAACACCTGTTTTTTCGACCCTACAGGAGGGGGGGACCCTATCCTCTTTAGCCATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Golfingia vulgaris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Golfingia vulgaris

Golfingia vulgaris is a marine invertebrate belonging to the phylum Sipuncula, the peanut worms. It is a cylindrical, unsegmented worm with a crown of tentacles around the mouth. It lives in burrows in shallow seas in various parts of the world.

Contents

Description [edit]

Like other sipunculans, the body is divided into a larger rear end known as the trunk and a narrower front end known as the introvert. The trunk is cylindrical and can reach 200 mm in length but is more commonly 20-50 mm.[1] It varies in colour from grey to white to yellow-brown.[2] The two ends of the trunk are often pigmented dark brown or black. The introvert can be retracted into the trunk by the retractor muscles of which there are usually four but occasionally three.[1] The introvert bears many dark brown, slightly bent hooks. These are arranged irregularly unlike the similar species Golfingia elongata where the hooks are arranged in rings.[3] Young specimens have a crown of around 20 small, finger-like tentacles arranged in a circle around the mouth. As the worm grows the number of tentacles can increase to over 150 and they are arranged in three or more circles.[4] The entoproct Loxosomella phascolosomata often attaches itself to the worm.[4]

Taxonomy [edit]

It was first described in 1827 by the French zoologist Henri Marie Ducrotay de Blainville who gave it the name Sipunculus vulgaris. It is now placed in the genus Golfingia which was created by the British zoologist E. Ray Lankester in 1885 and named to celebrate a golfing holiday in St Andrews, Scotland.[1][5] The species is variable in appearance and has several synonyms. A varying number of subspecies are recognized.[4]

Distribution and habitat [edit]

It has a widespread but patchy distribution around the world. It occurs in the eastern Atlantic Ocean from Greenland and Scandinavia south to West Africa and also occurs in the Mediterranean Sea, Adriatic Sea and Red Sea. It is found locally in the western Pacific Ocean and there is a record from the eastern Pacific off British Columbia. The subspecies G. v. herdmani is found in parts of the Indian Ocean and around Australia.[1]

It is found in mud, sand and gravel at depths of 5-2000 m, mainly occurring in waters less than 500 m deep. There is also one record from 5,540 m down in the Kuril-Kamchatka Trench. G. v. herdmani occurs in warm, shallow water.[1]

References [edit]

  1. ^ a b c d e Cutler, Edward B. (1994) The Sipuncula: their Systematics, Biology, and Evolution, Cornell University Press, Ithaca, New York.
  2. ^ Barnes, M.K.S. (2008) Golfingia vulgaris. A sipunculid worm. Marine Life Information Network: Biology and Sensitivity Key Information Sub-programme, Plymouth: Marine Biological Association of the United Kingdom. Accessed 29 March 2009.
  3. ^ Fish, Susan (2006) A Student's Guide to the Seashore, Cambridge University Press.
  4. ^ a b c de Kluijver, Mario & Sarita Ingalsuo. Golfingia vulgaris, Marine Species Identification Portal. Accessed 29 March 2009.
  5. ^ Cowles, Dave (2007) Golfingia vulgaris. Accessed 29 March 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!