Overview

Comprehensive Description

Type Material

Holotype at Museum National d'Histoire Naturelle, Paris (MNHN): A’ (R) 1868. Nº 427a (Saiz Salinas, 1984). Saiz Salinas (1984) reported one specimen not-previously dissected.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Material

Holotype at Museum National d'Histoire Naturelle, Paris (MNHN): A’ (R) 1868. Nº 427a (Saiz Salinas, 1984). Saiz Salinas (1984) reported one specimen not-previously dissected.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Locality

According to Saiz Salinas (1984) the vial containing the type in the Museum of Paris has 3 labels all listing the type locality as Mer des Indes (old French name for Indian Ocean); however, De Quatrefages (1865) in his description of the species reported that those specimens were provided by Mr. Quoy and Mr. Gairmard without any reference to the original collecting place. Saiz Salinas (1984) considers the type locality as unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Locality

According to Saiz Salinas (1984) the vial containing the type in the Museum of Paris has 3 labels all listing the type locality as Mer des Indes (old French name for Indian Ocean); however, De Quatrefages (1865) in his description of the species reported that those specimens were provided by Mr. Quoy and Mr. Gairmard without any reference to the original collecting place. Saiz Salinas (1984) considers the type locality as unknown.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Description

This species has only compressed unidentate hooks arranged in rings, well defined anal and caudal shields with extensive grooves or furrows, and two retractor muscles united for most of their length. Aspidosiphon laevis is a widespread species, but is usually present in low densities in tropical shallow waters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Description

This species has only compressed unidentate hooks arranged in rings, well defined anal and caudal shields with extensive grooves or furrows, and two retractor muscles united for most of their length Aspidosiphon laevis is a widespread species, but is usually present in low densities in tropical shallow waters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

circum-(sub)tropical
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European waters (ERMS scope), Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

(From Cutler, 1994)

Commonly present in low densities in tropical waters, this species is considered to be widespread. There are records in the Indo-West Pacific from Durban to Red Sea, in the Andaman Island, Malaya to southern Japan, Indonesia, the Great Barrier Reef, and islands east to Hawaii. It is also present in the western Atlantic Ocean from the 20ºS to 31ºN, the Caribbean, and in the eastern Atlantic from Canary and Cape Verde islands to the Gulf of Guinea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

(From Cutler, 1994)

Commonly present in low densities in tropical waters, this species is considered to be widespread. There are records in the Indo-West Pacific from Durban to Red Sea, in the Andaman Island, Malaya to southern Japan, Indonesia, the Great Barrier Reef, and islands east to Hawaii. It is also present in the western Atlantic Ocean from the 20ºS to 31ºN, the Caribbean, and in the eastern Atlantic from Canary and Cape Verde islands to the Gulf of Guinea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

(From Cutler 1994, Saiz Salinas 1984)

External anatomy

Introvert commonly approximately as long as the trunk.

Tentacles up to 24 surround the nuchal organ. They are short and fused laterally.

On the distal introvert compressed unidentate, sharply, pointed or blunt hooks are arranged in many rings. The height of the hook (20-80 µm) is correlated with trunk length. Some scattered compressed hooks are present.

The anal shield is solid with 10-15 longitudinal grooves.

The caudal shield is conical and grooved. Saiz Salinas (1984) described 24 radial grooves for the type material.

Internal anatomy

The trunk wall has 25-35 longitudinal muscles bands, which often anastomose and usually can be seen through the trunk wall. The circular muscle layer is subdivided in bands, but these are not always distinct.

Intestine attached anteriorly and posteriorly by spindle muscle. A distinctive feature of the latter structure is the bifurcation near its anterior end. The contractile vessel of many specimens has vesicular pouches or swellings along the portion united with the retractors.

Rectal caecum present and can be single or complex with lateral branches.

Nephridia are usually more than half of the trunk length.

A pair of retractor muscles, fused for most of their length, originates in front of the caudal shield about 65-80% of the distance towards the posterior end of the trunk.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

(From Cutler 1994, Saiz Salinas 1984)

External anatomy

Introvert commonly approximately as long as the trunk.

Tentacles up to 24 surround the nuchal organ. They are short and fused laterally.

On the distal introvert compressed unidentate, sharply, pointed or blunt hooks are arranged in many rings. The height of the hook (20-80 µm) is correlated with trunk length. Some scattered compressed hooks are present.

The anal shield is solid with 10-15 longitudinal grooves.

The caudal shield is conical and grooved. Saiz Salinas (1984) described 24 radial grooves for the type material.

Internal anatomy

The trunk wall has 25-35 longitudinal muscles bands, which often anastomose and be usually can be seen through the trunk wall. The circular muscle layer is subdivided in bands, but these are not always distinct.

Intestine attached anteriorly and posteriorly by spindle muscle. A distinctive feature of the latter structure is the bifurcation near its anterior end. The contractile vessel of many specimens has vesicular pouches or swellings along the portion united with the retractors.

Rectal caecum present and can be single or complex with lateral branches.

Nephridia are usually more than half of the trunk length.

A pair of retractor muscles, fused for most of their length, originates in front of the caudal shield about 65-80% of the distance towards the posterior end of the trunk.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Haldar (1991) reported one worm measuring 138 mm in length by 42 mm width.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Haldar (1991) reported one worm measuring 138 mm in length by 42 mm width.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Aspidosiphon speciosus Gerould, 1913
Catalog Number: USNM 16320
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Alcohol (Ethanol)
Collector(s): H. Hemphill
Year Collected: 1885
Locality: Florida Keys, Key West, Florida, United States, Gulf of Mexico, North Atlantic Ocean
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

coastal
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 14 specimens in 1 taxon.
Water temperature and chemistry ranges based on 11 samples.

Environmental ranges
  Depth range (m): 12 - 39
  Temperature range (°C): 23.867 - 27.314
  Nitrate (umol/L): 0.356 - 1.522
  Salinity (PPS): 35.646 - 36.248
  Oxygen (ml/l): 4.637 - 4.941
  Phosphate (umol/l): 0.109 - 0.195
  Silicate (umol/l): 1.202 - 2.550

Graphical representation

Depth range (m): 12 - 39

Temperature range (°C): 23.867 - 27.314

Nitrate (umol/L): 0.356 - 1.522

Salinity (PPS): 35.646 - 36.248

Oxygen (ml/l): 4.637 - 4.941

Phosphate (umol/l): 0.109 - 0.195

Silicate (umol/l): 1.202 - 2.550
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

(From Cutler, 1994)

This species is an inhabitant of coral rubble in shallow waters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

This species is an inhabitant of coral rubble in shallow waters.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aspidosiphon laevis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATTTTATTTTTGGAATTTGATCAGGATTAATAGGAACTTCCATGAGTTTATTAATTCGAGCTGAGCTAGGACAGCCAGGGTCTCTGTTAGGTAGAGACCAACTATATAATGTAGTTGTAACAGCTCATGCCTTCTTAATGATTTTTTTTCTTGTTATACCGGTATTAATTGGCGGCTTTGGTAATTGACTAATCCCACTAATGTTAGGTGCTCCAGATATGGCTTTTCCGCGTCTTAATAATATGAGGTTTTGATTATTGCCTCCAGCTTTAATCTTATTATTAGGGTCTGCGGCCGTTGAAAAAGGGGCCGGGACTGGGTGGACTGTTTATCCCCCTCTTGCTGGAGCTTTAGCTCATGCTGGTCCTTCTGTTGATTTAGCTATTTTTTCTCTTCATCTAGCTGGTGCAAGGTCTATTTTAGGTTCTTTAAATTTTATTACTACGGTAATCAATATACGTCCGGAAGGATTGACCTGAGAGCGGATCCCTCTTTTTGTTTGAGCTGCTTTTATTACTGTGATTTTATTATTATTGTCACTTCCAGTTCTAGCGGGGGCTATTACTATATTATTAACAGACCGTAATCTAAACACTGCTTTCTTTGATCCTAGAGGTGGTGGAGATCCTATTTTATTTTCTCATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aspidosiphon laevis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!