Overview

Comprehensive Description

General Description

This species is the most common and widespread Aspidosiphon in tropical regions, inhabiting coral rubble and soft rocks in shallow water. It is distinguished from it congeners by the presence of dark conical hooks on the posterior portion of the introvert. Asexual reproduction, rare among sipunculans, occurs by transverse fission into two unequal parts. A posterior constriction is commonly observed in specimens collected from the natural habitat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

(From Cutler, 1994)

This species is considered to be the most widespread Aspidosiphon in tropical waters, being present in the Indian Ocean and Western Pacific oceans, from south central Japan to northern Australia to Hawaii. It is present in the Red Sea and Israelian waters. In the western Atlantic it occurs from northern Brazil to the Caribbean, Florida and Bermuda.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

(From Cutler, 1994, Migotto and Ditadi, 1988, and Stephen and Edmonds, 1972)

External anatomy

Introvert nearly as long as the trunk.

Six to 12 stubby tentacles surround the nuchal organ.

On the distal part of the introvert bidentate compressed hooks are arranged in rings. Scattered on the posterior portion of the introvert are dark conical hooks, with a nearly circular cross section and a gentle posterior curve (conical hooks type C according Cutler, 1994).

The anal shield is ungrooved.

The caudal shield is not well developed, and in many worms is barely discernible.

Internal anatomy

The longitudinal muscle layer on the trunk wall is often split in the area under the anal shield.

The intestine is normally in a helical coil, whichmay appear loosely formed in some specimens. A spindle muscle fixes the intestine anteriorly and posteriorly.

Rectal caecum can be present in some worms.

Nephridia are reddish-brown, about as long as the trunk and attached for their whole length.

A pair of retractor muscles originates about 85-95% of the distance to the posterior end of the trunk.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

The common size for this species is between 10-15 mm long, but specimens up to 57 mm have been recorded (Cutler 1994).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

coastal in coral and soft rock
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 5 samples.

Environmental ranges
  Depth range (m): 0.5 - 20
  Temperature range (°C): 24.946 - 25.146
  Nitrate (umol/L): 0.009 - 0.039
  Salinity (PPS): 34.939 - 34.956
  Oxygen (ml/l): 4.813 - 4.874
  Phosphate (umol/l): 0.115 - 0.140
  Silicate (umol/l): 1.403 - 1.820

Graphical representation

Depth range (m): 0.5 - 20

Temperature range (°C): 24.946 - 25.146

Nitrate (umol/L): 0.009 - 0.039

Salinity (PPS): 34.939 - 34.956

Oxygen (ml/l): 4.813 - 4.874

Phosphate (umol/l): 0.115 - 0.140

Silicate (umol/l): 1.403 - 1.820
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Often occurring in great densities, it is found in borings in coral rubble and soft rocks in shallow water. As a rock-boring species it contributes to the erosion of reefs by weakening the supporting structures of the corals, consequently increasing their susceptibility to breakage and destruction by current and wave action (Rice, 1979).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

In 1970, Rice described asexual reproduction in this species, which occurs by a transverse fission of the body into two unequal parts. Before the fission each part regenerates the structures essential to the formation of a worm. The fission appears near the end of the trunk and the daughter part (the smaller portion of the trunk) regenerates an anterior body, including introvert, anterior gut, retractor muscle and nephridia, while the parent part (large portion of the trunk) regenerates only the posterior part of the trunk.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Kawauchi, Gisele Y.

Source: Sipuncula LifeDesk

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aspidosiphon elegans

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

TTACTTCATTCTTGGTATTTGAGCTGGGCTTATAGGAACTTCTATAAGGTTATTGATTCGTGCTGAGTTAGGTCAGCCCGGCTCTTTACTGGGAAGAGATCAATTATATAATGTTGTTGTAACGGCCCACGCATTTTTAATAATTTTTTTTCTTGTTATGCCGGTTTTAATTGGAGGGTTTGGTAATTGATTGATTCCGTTGATGTTGGGGGCACCTGATATGGCTTTTCCTCGATTAAATAATATAAGGTTTTGGTTATTACCTCCTGCTTTAATTTTGTTATTAGCTTCTAGGGCCGTAGAAAAGGGAGTGGGAACTGGATGGACTGTTTATCCTCCTTTGTCGGGTGCTTTGGCTCATGCGGGAGCGTCTGTGGATCTAGCTATTTTTTCTCTTCATTTAGCTGGTGTAAGGTCTATTTTAGGATCATTAAATTTTATTACTACTGTTATTAATATGCGGCCAGAAGAAATGAGCTGGGAACGAATTCCTTTGTTTGTTTGGGCTGCTTTTATTACTGTAATTTTACTGTTGTTGGCTCTTCCTGTATTGGCTGGAGCTATTACTATGTTGTTAACGGATCGAAATTTAAATACCGCCTTTTTTGATCCTAGGGGAGGAGGAGATCCTGTGCTATTTTCTCATTTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Aspidosiphon elegans

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!