Overview

Brief Summary

Biology

This sea-spider feeds on a variety of animals, such as small marine worms, sea-anemones and whelk egg-capsules (2). Individuals migrate to the sublittoral zone during the winter breeding season. The sexes are separate, and males and females cling together during fertilisation. The eggs are released from openings at the base of the female's legs, and are fertilised externally (2). The male carries the eggs around on the special egg-carrying appendages. The larvae are similar in appearance to the adults, and undergo a series of moults before reaching the adult stage after five months. The average life-span is thought to be around one year (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The sea-spiders, or pycogonids, are an unusual group of marine arthropods, which are completely unrelated to terrestrial spiders, despite superficially resembling them (3). The body is slender, segmented, and divided into two regions, the head and the trunk (2). The head features a number of pairs of appendages, including two pairs of feeding appendages (chelifores) with pincers at the tips, a proboscis with the mouth at the end, and both sexes have a pair of egg-carrying 'legs' (2). The trunk bears four pairs of long, spindly legs, and has a small projection at the rear called the abdomen (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Nymphon gracile has a smooth body up to 1 cm long. Its body segments are longer than they are wide and the proboscis is at least twice as long as it is wide. The eight legs are long and slender and roughly 3 to 4 times the length of the body. Chelifores of Nymphon gracile have well developed chela and the palps consist of 5 segments, the ultimate and penultimate segments being equal in length. Although the body is translucent, there is a visible, pink alimentary canal. Ovigerous legs occur in both sexes and have prominent toothed spines which are used to clean the surface of the body. Nymphon gracile commonly migrate into the sublittoral to breed during winter months. Males then carry the eggs back to the intertidal zone sometime in March or April. Nymphon gracile generally reach maturity within 5 months and average life expectancy is about a year.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Found on the shores of north-west Europe, and common around British coasts (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

coastal to slope
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 16 samples.

Environmental ranges
  Depth range (m): 0 - 650
  Temperature range (°C): 6.695 - 10.290
  Nitrate (umol/L): 1.473 - 16.105
  Salinity (PPS): 27.525 - 35.590
  Oxygen (ml/l): 4.562 - 6.963
  Phosphate (umol/l): 0.288 - 0.977
  Silicate (umol/l): 1.720 - 7.872

Graphical representation

Depth range (m): 0 - 650

Temperature range (°C): 6.695 - 10.290

Nitrate (umol/L): 1.473 - 16.105

Salinity (PPS): 27.525 - 35.590

Oxygen (ml/l): 4.562 - 6.963

Phosphate (umol/l): 0.288 - 0.977

Silicate (umol/l): 1.720 - 7.872
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Nymphon gracile can be found in the intertidal and sublittoral of rocky shores.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species can be found on the middle and lower shore underneath stones and seaweeds (2). It is able to swim, and also lives in shallow water (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nymphon gracile

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GAACGTTGATTTAGATCTACTAATCATAAAGATATTGGAACTTTATATATAATTTTTGGTCTTTGGGCTGCTATAATTGGTTTAAGATTTAGTGTAATTATTCGATTGGAATTAGGAACACCTGGTATCTTGATTGGTAAT---GATCAAGTATATAATGTTATTGTTACTTCTCATGCTTTTATTATAATTTTTTTTATAGTGATACCCGTAATAATAGGGGGATTTGGTAATTGACTTTTACCTTTAATAGTTGGAGCTCCTGATATGGCATTTCCTCGTTTAAATAATTTTAGTTTTTGAATATTACCTCCTGCTTTAATATTGTTAGTAACTTCTTCTTTAGTAGAAAGAGGAGCAGGAACTGGTTGAACTGTCTATCCTCCTTTATCAGGTAATTTAGCTCATTCTGGGGTTTCTGTTGATTTATGTATTTTTTCTTTACATGTGGCTGGAATTTCTTCAATTTTAGGATCATTAAATTTTATAGCTACTTTAAAAAATATATCTCCATTGAAAATAAAATATGAAAATATACCTTTATTTAATTGAAGTGTATTAATTACAGCTTTTTTATTGATTAGGTCTCTTCCTGTTTTAGCTGGGGCTATTACTATACTTCTTTTGGATCGAAATTTTAATACTAGATTTTTTGATCCTTCTGGAGGTGGGGATCCTATTCTTTATCAACATTTATTTTGGTTTTTTGGACACCCTGAAGTTTATATTCTTATTTTACCTGGTTTTGGAATTATTTCTCATGTAATAATAGGTCATACTAATAAAAAAGAAGTTTTTGGGAGCCTAGGTATAATTTATTCAATGATTGCAGTAGGTATATTAGGTTTTATTGTTTGAGCTCATCATATATTTACTGTTGGTTTGGATGTGGATACTCGAGCTTATTTTTCAGCTGCTACTATAATTATTGCAATTCCTACTGGAATTAAGGTTTTTAGATGAATAGCGACTATACATGGAAGA---AAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nymphon gracile

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Status

Common and widespread (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

Specific conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!