Overview

Distribution

semi-cosmopolitan in temperate to tropical waters
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

pelagic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 193 specimens in 1 taxon.
Water temperature and chemistry ranges based on 171 samples.

Environmental ranges
  Depth range (m): 1 - 3513
  Temperature range (°C): 2.451 - 27.010
  Nitrate (umol/L): 0.166 - 31.788
  Salinity (PPS): 34.901 - 37.199
  Oxygen (ml/l): 0.752 - 5.408
  Phosphate (umol/l): 0.090 - 2.394
  Silicate (umol/l): 1.156 - 45.864

Graphical representation

Depth range (m): 1 - 3513

Temperature range (°C): 2.451 - 27.010

Nitrate (umol/L): 0.166 - 31.788

Salinity (PPS): 34.901 - 37.199

Oxygen (ml/l): 0.752 - 5.408

Phosphate (umol/l): 0.090 - 2.394

Silicate (umol/l): 1.156 - 45.864
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Doliolum nationalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTACGTTGGCTTTTTTCTACGAATCATAAAGATATCAGAACCTTATATTTCTTATTTAGAATATGAGCAAGAATAATTAGAACTAGAATAAGTGTTTTAATCCGAATCGAGCTAAGAAAAGCTAGAACGGTTTGAGCAGATGACGGTCAGGTCTATAATGTTATAGTGACCGCCCACGCTTTTGTGATAATTTTCTTCTTTGTAATACCTGTAACCCTAAGAAGGTTCAGAAATTGACTAATCCCTTTAATAGTAGGGGCCCCAGACATGGCCTTCCCCCGGATGAACAACCTAAGCTTTTGGCTTCTCCCTCCGGCCTTCTTTCTCTTACTTCTATCCTCATTTGTAGGTAGGAGGGCAGGGACTAGGTGGACTGTCTACCCTCCTCTTTCAAGAAACCTAGCGCACGCCGGACCTTCAGTTGATTGCGCTATCTTTTCTCTTCATCTAGCCAGAGTATCTAGTATTTTAGGGTCTATTAACTTCTTAGTAACTATAATAAACATAATAAGTAAAGGGCAAACTTACGGGAACCTATCCTTATTTTGTTGGTCCATTGTAGTCACTACTATTCTGTTAATTCTATCTCTACCAGTGCTGGCTGCGGCTATTACAATACTTCTATTTGATCGTAATTTCAACACTTCCTTCTTTGATCCTGCTAGAGGGGGTGACCCAATTCTTTACCAACATCTATTTTGGTTCTTCAGGCACCCTGAAGTGTATATCCTAATTCTCCCTAGATTTGGGATTGTGAGCCATACTGTAGCCTATTACAGCGGTAAAAAGGAGGTATTTAGGTACTACAGAATAGTGTGGGCTATACTAAGGATCAGATTCCTTAGGTTCCTAGTGTGAGCCCACCACATATATACAGTAAGAATAGACACAGATTCTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Doliolum nationalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!