Overview
Distribution
European waters (ERMS scope), Greek Exclusive Economic Zone, Mediterranean Sea, North West Atlantic, Swedish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone
-
van der Land, J.; van Soest, R.W.M. (2001). Thaliacea, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 355-356
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1418
-
MEDIN (2011). UK checklist of marine species derived from the applications Marine Recorder and UNICORN, version 1.0.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=149081
-
Koukouras, Athanasios. (2010). Check-list of marine species from Greece. Aristotle University of Thessaloniki. Assembled in the framework of the EU FP7 PESI project.
http://www.marinespecies.org/asteroidea/aphia.php?p=sourcedetails&id=142068
-
Dyntaxa (2013) Swedish Taxonomic Database. Accessed at www.dyntaxa.se [15-01-2013].
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=165516
Trusted
semi-cosmopolitan in temperate to tropical waters
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Ecology
Habitat
pelagic
-
UNESCO-IOC Register of Marine Organisms
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1318
Trusted
Depth range based on 193 specimens in 1 taxon.
Water temperature and chemistry ranges based on 171 samples.
Environmental ranges
Depth range (m): 1 - 3513
Temperature range (°C): 2.451 - 27.010
Nitrate (umol/L): 0.166 - 31.788
Salinity (PPS): 34.901 - 37.199
Oxygen (ml/l): 0.752 - 5.408
Phosphate (umol/l): 0.090 - 2.394
Silicate (umol/l): 1.156 - 45.864
Graphical representation
Depth range (m): 1 - 3513
Temperature range (°C): 2.451 - 27.010
Nitrate (umol/L): 0.166 - 31.788
Salinity (PPS): 34.901 - 37.199
Oxygen (ml/l): 0.752 - 5.408
Phosphate (umol/l): 0.090 - 2.394
Silicate (umol/l): 1.156 - 45.864
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 171 samples.
Environmental ranges
Depth range (m): 1 - 3513
Temperature range (°C): 2.451 - 27.010
Nitrate (umol/L): 0.166 - 31.788
Salinity (PPS): 34.901 - 37.199
Oxygen (ml/l): 0.752 - 5.408
Phosphate (umol/l): 0.090 - 2.394
Silicate (umol/l): 1.156 - 45.864
Graphical representation
Depth range (m): 1 - 3513
Temperature range (°C): 2.451 - 27.010
Nitrate (umol/L): 0.166 - 31.788
Salinity (PPS): 34.901 - 37.199
Oxygen (ml/l): 0.752 - 5.408
Phosphate (umol/l): 0.090 - 2.394
Silicate (umol/l): 1.156 - 45.864
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Doliolum nationalis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GTACGTTGGCTTTTTTCTACGAATCATAAAGATATCAGAACCTTATATTTCTTATTTAGAATATGAGCAAGAATAATTAGAACTAGAATAAGTGTTTTAATCCGAATCGAGCTAAGAAAAGCTAGAACGGTTTGAGCAGATGACGGTCAGGTCTATAATGTTATAGTGACCGCCCACGCTTTTGTGATAATTTTCTTCTTTGTAATACCTGTAACCCTAAGAAGGTTCAGAAATTGACTAATCCCTTTAATAGTAGGGGCCCCAGACATGGCCTTCCCCCGGATGAACAACCTAAGCTTTTGGCTTCTCCCTCCGGCCTTCTTTCTCTTACTTCTATCCTCATTTGTAGGTAGGAGGGCAGGGACTAGGTGGACTGTCTACCCTCCTCTTTCAAGAAACCTAGCGCACGCCGGACCTTCAGTTGATTGCGCTATCTTTTCTCTTCATCTAGCCAGAGTATCTAGTATTTTAGGGTCTATTAACTTCTTAGTAACTATAATAAACATAATAAGTAAAGGGCAAACTTACGGGAACCTATCCTTATTTTGTTGGTCCATTGTAGTCACTACTATTCTGTTAATTCTATCTCTACCAGTGCTGGCTGCGGCTATTACAATACTTCTATTTGATCGTAATTTCAACACTTCCTTCTTTGATCCTGCTAGAGGGGGTGACCCAATTCTTTACCAACATCTATTTTGGTTCTTCAGGCACCCTGAAGTGTATATCCTAATTCTCCCTAGATTTGGGATTGTGAGCCATACTGTAGCCTATTACAGCGGTAAAAAGGAGGTATTTAGGTACTACAGAATAGTGTGGGCTATACTAAGGATCAGATTCCTTAGGTTCCTAGTGTGAGCCCACCACATATATACAGTAAGAATAGACACAGATTCTCGAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Doliolum nationalis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
