Overview
Distribution
western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); Cobscook Bay
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Carolinian, Gulf of Maine/Bay of Fundy, Gulf of St. Lawrence - Eastern Scotian Shelf, Scotian Shelf, Virginian
-
Intergovernmental Oceanographic Commission (IOC) of UNESCO. The Ocean Biogeographic Information System (OBIS)
http://www.marinespecies.org/hemichordata/aphia.php?p=sourcedetails&id=152430
Trusted
Ecology
Habitat
infralittoral of the Gulf and estuary
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 120 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): -99 - 48.6
Temperature range (°C): 13.906 - 13.906
Nitrate (umol/L): 1.399 - 1.399
Salinity (PPS): 32.546 - 32.546
Oxygen (ml/l): 6.000 - 6.000
Phosphate (umol/l): 0.399 - 0.399
Silicate (umol/l): 1.668 - 1.668
Graphical representation
Depth range (m): -99 - 48.6
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 1 sample.
Environmental ranges
Depth range (m): -99 - 48.6
Temperature range (°C): 13.906 - 13.906
Nitrate (umol/L): 1.399 - 1.399
Salinity (PPS): 32.546 - 32.546
Oxygen (ml/l): 6.000 - 6.000
Phosphate (umol/l): 0.399 - 0.399
Silicate (umol/l): 1.668 - 1.668
Graphical representation
Depth range (m): -99 - 48.6
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Saccoglossus kowalevskii
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
GTGTCGTTTATTCGTCGATGATTATTTTCAACTAATCACAAGGATATTGGAACTCTTTATTTTATATTTGGGGCATGGGCTGGAATGATAGGAACTGGCTTAAGTCTGTTGATTCGGATTGAACTAGCTCAGCCTGGGCCTTTTTTGGGGGATGATCAGATTTATAATGTTATAGTAACTGCACATGCATTTGTTATGATTTTTTTTATGGTTATGCCTATTATGATAGGGGGGTTTGGAAATTGATTGATTCCTCTTATGTTGGGAGCTCCAGATATGGCATTTCCACGGTTAAACAATATGAGTTTTTGGCTCTTACCTCCAGCATTTTTACTATTACTATCCTCAGCAGCAGTTGAAAGTGGAGCTGGGACAGGTTGGACAGTTTATCCTCCCTTATCAGGAAATTTAGCTCACGGAGGGGGTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCGGGGATTTCTTCAATTTTAGGTGCTATTAATTTCATGACTACAGTAATTAATATGCGTGCAGCAGGAATTACGTGAAGTCGTCTTCCTTTATTTGTTTGATCTATTTTTATTACAGTTATTTTACTATTATTATCTTTACCAGTTTTGGCAGGTGGTATAACTATGTTATTGACAGACCGAAATCTAAATACAACATTTTTTGATCCTGCTGGAGGAGGTGATCCAATTTTGTACCAACATCTCTTTTGATTTTTTGGGCATCCAGAAGTATATATTTTGATTCTTCCAGGGTTTGGGATTATTTCTCATGTAATAGCTTTTTATTCCGGGAAAAAGGAGACTTTTGGCTATTTAGGCATGGTTTATGCAATGTTGGCTATAGGAATTTTAGGGTTTTTGGTTTGGGCACATCATATGTTTACTGTTGGGATGGATGTAGATACGCGAGCTTACTTTACTGCTGCAACTATGGTTATTGCTGTTCCAACAGGAATTAAGATTTTTAGTTGGCTAGCAACGTTACATGGTTCAGCTTTACAGTGGGAGACACCGTTATTGTGGGCTTTGGGATTTGTTTTTTTATTTACATTAGGTGGATTGACAGGAATAGTTTTATCCAATTCTTCATTAGATGTGGTTCTCCATGATACTTATTATGTGGTGGCCCATTTTCATTATGTTCTTTCAATGGGGGCTGTTTTTGCAATTTTTGCAGGGTTTATTCATTGGTTTCCTTTATTTACTGGGTATGGCCTTCATCCGGTGTGAACTAAGGTTCATTTTTGAACTATGTTTTTAGGGGTAAATGTGACGTTTTTTCCCCAGCATTTTTTAGGATTAGCAGGGATGCCTCGTCGTTACTCAGATTTCCCAGATGCTTATACAACTTGAAATGTTGTGAGTTCAGTAGGGTCTATTATTTCATTAACATCTGTTATTCTTTTTGTGTTTATAGTGTGGGAAGCGTTTGCAAGTTGTCGTCCAACATTACAGCCAAGCCAAGTTGTATCATCCTCAGAGTGACAATATAATTTTCCTCCAGCTCATCATACAAATGAGGAGTTACCTATTACTTTTTATCATAAGTCTTAA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Saccoglossus kowalevskii
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
