Overview

Distribution

western slope of Newfoundland, including the southern part of the Strait of Belle Isle but excluding the upper 50m in the area southwest of Newfoundland; Prince Edward Island (from the northern tip of Miscou Island, N.B. to Cape Breton Island south of Cheticamp, including the Northumberland Strait and Georges Bay to the Canso Strait causeway); Cobscook Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Carolinian, Gulf of Maine/Bay of Fundy, Gulf of St. Lawrence - Eastern Scotian Shelf, Scotian Shelf, Virginian
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

infralittoral of the Gulf and estuary
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 120 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): -99 - 48.6
  Temperature range (°C): 13.906 - 13.906
  Nitrate (umol/L): 1.399 - 1.399
  Salinity (PPS): 32.546 - 32.546
  Oxygen (ml/l): 6.000 - 6.000
  Phosphate (umol/l): 0.399 - 0.399
  Silicate (umol/l): 1.668 - 1.668

Graphical representation

Depth range (m): -99 - 48.6
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Saccoglossus kowalevskii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGTCGTTTATTCGTCGATGATTATTTTCAACTAATCACAAGGATATTGGAACTCTTTATTTTATATTTGGGGCATGGGCTGGAATGATAGGAACTGGCTTAAGTCTGTTGATTCGGATTGAACTAGCTCAGCCTGGGCCTTTTTTGGGGGATGATCAGATTTATAATGTTATAGTAACTGCACATGCATTTGTTATGATTTTTTTTATGGTTATGCCTATTATGATAGGGGGGTTTGGAAATTGATTGATTCCTCTTATGTTGGGAGCTCCAGATATGGCATTTCCACGGTTAAACAATATGAGTTTTTGGCTCTTACCTCCAGCATTTTTACTATTACTATCCTCAGCAGCAGTTGAAAGTGGAGCTGGGACAGGTTGGACAGTTTATCCTCCCTTATCAGGAAATTTAGCTCACGGAGGGGGTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCGGGGATTTCTTCAATTTTAGGTGCTATTAATTTCATGACTACAGTAATTAATATGCGTGCAGCAGGAATTACGTGAAGTCGTCTTCCTTTATTTGTTTGATCTATTTTTATTACAGTTATTTTACTATTATTATCTTTACCAGTTTTGGCAGGTGGTATAACTATGTTATTGACAGACCGAAATCTAAATACAACATTTTTTGATCCTGCTGGAGGAGGTGATCCAATTTTGTACCAACATCTCTTTTGATTTTTTGGGCATCCAGAAGTATATATTTTGATTCTTCCAGGGTTTGGGATTATTTCTCATGTAATAGCTTTTTATTCCGGGAAAAAGGAGACTTTTGGCTATTTAGGCATGGTTTATGCAATGTTGGCTATAGGAATTTTAGGGTTTTTGGTTTGGGCACATCATATGTTTACTGTTGGGATGGATGTAGATACGCGAGCTTACTTTACTGCTGCAACTATGGTTATTGCTGTTCCAACAGGAATTAAGATTTTTAGTTGGCTAGCAACGTTACATGGTTCAGCTTTACAGTGGGAGACACCGTTATTGTGGGCTTTGGGATTTGTTTTTTTATTTACATTAGGTGGATTGACAGGAATAGTTTTATCCAATTCTTCATTAGATGTGGTTCTCCATGATACTTATTATGTGGTGGCCCATTTTCATTATGTTCTTTCAATGGGGGCTGTTTTTGCAATTTTTGCAGGGTTTATTCATTGGTTTCCTTTATTTACTGGGTATGGCCTTCATCCGGTGTGAACTAAGGTTCATTTTTGAACTATGTTTTTAGGGGTAAATGTGACGTTTTTTCCCCAGCATTTTTTAGGATTAGCAGGGATGCCTCGTCGTTACTCAGATTTCCCAGATGCTTATACAACTTGAAATGTTGTGAGTTCAGTAGGGTCTATTATTTCATTAACATCTGTTATTCTTTTTGTGTTTATAGTGTGGGAAGCGTTTGCAAGTTGTCGTCCAACATTACAGCCAAGCCAAGTTGTATCATCCTCAGAGTGACAATATAATTTTCCTCCAGCTCATCATACAAATGAGGAGTTACCTATTACTTTTTATCATAAGTCTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Saccoglossus kowalevskii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!