Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

With its formal description in 1995, Symbion pandora, discovered living on the mouthparts of Norwegian Lobsters (Nephrops norvegicus) in the North Atlantic, became the first species described and placed in the new phylum Cycliophora (Funch and Kristensen 1995). Interestingly, the sessile (i.e., attached to substrate) feeding stage of S. pandora had been known since the 1960s, but was not described until 1995 (Funch and Kristensen 1997, cited in Kristensen 2002).

The cycliophoran body is divided into an anterior buccal funnel, an oval trunk, and a posterior acellular stalk and adhesive disc by which the animal attaches itself to setae (flexible hair-like projections) on the host's mouthparts. Females are about 350 µm long and 100 µm wide. They are suspension feeders, obtaining food by creating water currents with dense cilia around the open end of the buccal funnel. The U-shaped gut is ciliated along its entire length, ending with an anus located near the base of the buccal funnel. Circulation and gas exchange are presumably accomplished by simple diffusion. Obst and Funch (2003) reported S. pandora population densities ranging from fewer than 100 to more than 500 feeding stages per mouthpart.

The Cycliophora currently includes just two described species: Symbion pandora Funch and Kristensen, 1995 from the mouthparts of the Norwegian Lobster (Nephrops norvegicus) and S. americanus Obst, Funch, and Kristensen, 2006 from the mouthparts of the American Lobster (Homarus americanus) (an apparently distinct third species lives on the mouthparts of the European Lobster [Homarus gammarus]; Obst et al. 2005) . For at least S. americanus, there is evidence suggesting that this nominal species may in fact include several cryptic species (Obst et al. 2005, 2006; Baker and Giribet 2007; Baker et al. 2007), which could turn out to be true for S. pandora as well. All three known hosts of Cycliophora are members of the lobster family Nephropidae. Reports of cycliophorans on nematodes and non-nephropid crustaceans (e.g., copepods) are apparently all in error and instead are based on observations of chonotrich ciliates. Examination by transmission electron microscopy is required to see that, in contrast to a cycliophoran, the ciliate consists of just a single cell with several nuclei. (Kristensen 2002)

Cycliophorans have a very complex life cycle that alternates between sexual and asexual phases. The most prominent stage is the asexual and sessile feeding stage, which lives attached to the setae of the host lobster's mouthparts and filters small food particles from the water. For a detailed description of the complex life cycle of Symbion pandora, see General Description; for a whimsical but informative account, check out the CreatureCast podcast on this topic.

A growing body of evidence suggests that the sister group to the Cycliophora is the Entoprocta (=Kamptozoa) (Fuchs et al. 2010 and references therein), consistent with the suggestion made by Funch and Kristensen (1995) in their original description, although cycliophorans share many similarities with the Rotifera and some molecular analyses have indicated a close relationship between these two groups (e.g., Winnepenninckx et al. 1998).

The phylum name Cycliophora is derived from Greek roots meaning "wheel bearing", referring to the circular mouth ring. The genus name Symbion is derived from Greek roots meaning "living together", referring to this animal's intimate association with its lobster host. The specific epithet pandora is a reference to the feeding stage, which contains both an inner bud and a Pandora larva with a miniature feeding stage inside, reminding the authors of Pandora's Box of Greek mythology. (Funch and Kristensen 1995)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Ecology

They live on the mouthparts of the Dublin Bay prawn or Norway lobster Nephrops norvegicus.
  • Costello, M.J.; Emblow, C.; White, R. (Ed.). (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50. Muséum national d'Histoire Naturelle: Paris, France. ISBN 2-85653-538-0. 463 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

It appears likely its distribution is related to that of its host.
  • Costello, M.J.; Emblow, C.; White, R. (Ed.). (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50. Muséum national d'Histoire Naturelle: Paris, France. ISBN 2-85653-538-0. 463 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Symbion pandora can be found on the lips of Norwegian lobsters, Nephrops norvegicus. They are found at depths of 20-40 meters (66-131 feet) from coastal Norway south to the coastline of the Mediterranean region.

Biogeographic Regions: atlantic ocean (Native )

  • Burton, M., R. Burton. 1989. Lobster. Pp. 1463 in Marshall Cavendish International Wildlife Encyclopedia. Long Island, NY: Marshall Cavendish Corporation.
  • Morris, S. 14 December 1995. A New Phylum From Lobster's lips. Nature, 378: 661.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Symbion pandora has a bilateral, sack-like body with no coelom. There are three basic life stages:

Asexual Feeding Stage- At this stage S. pandora is neither male nor female. It has a length of 347 um and a width of 113 um. On the posterior end of the sack-like body is a stalk with an adhesive disk, which attaches itself to the host. On the anterior end is a ciliated funnel (mouth) and an anus.

Male- S. pandora has a length of 84 um and a width of 42 um during this stage. It has no mouth or anus, which signifies the absence of a digestive system. It also has two reproductive organs.

Female- S. pandora is the same size as the male in this stage. It does, however, have a digestive system which collapses and reconstitutes itself as larva.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Funch, P., R. Kristensen. 14 December 1995. Cycliophora is a New Phylum with Affinites to Entoprocta and Ectoprocta. Nature, 378: 711-714.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Symbion pandora Funch & Mobjerg Kristensen, 1995
Catalog Number: USNM 1075202
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Year Collected: 2005
Locality: Kaldbak Fjord, Faroe Islands, North Atlantic Ocean
  • Paratype: Funch, P. & Mobjerg Kristensen, R. 1995. Cycliophora is a new phylum with affinities to Entoprocta and Ectoprocta. Nature. 378 (6558): 711-714.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Symbion pandora Funch & Mobjerg Kristensen, 1995
Catalog Number: USNM 1075201
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Preparation: Slide
Year Collected: 2005
Locality: Off Frederikshavn, Denmark, Nordjylland, Denmark, North Atlantic Ocean
Depth (m): 20 to 40
  • Paratype: Funch, P. & Mobjerg Kristensen, R. 1995. Cycliophora is a new phylum with affinities to Entoprocta and Ectoprocta. Nature. 378 (6558): 711-714.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Symbion pandora can be found on the mouth bristles of the Norwegian lobster. It attaches to the lobster with an adhesive disk located on its posterior end. Symbion pandora shares a symbiotic relationship with its host. It recieves easy access to food with out harming or helping the Norwegian lobster. This is called commensalism.

Habitat Regions: saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Symbion pandora attaches itself on the lips of Norwegian lobsters, where it then sweeps food particles into its ciliated, disk-shaped mouth. The digestive system is closely intertwined with the reproductive cycle. A unique feature of the digestive system of S. pandora is that it collapses and becomes larva.

Foraging Behavior: filter-feeding

  • Olsen, J. 18 December 1995. Microscopic Creature Ranks as Real Misfit. Detroit News.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

This species is parasitic on Norweigan lobsters.

Ecosystem Impact: parasite

Species Used as Host:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Symbion pandora reproduces both sexually and asexually. It reproduces asexually by young budding off from the asexual feeding stage. The sexual cycle begins only during the molting season of the Norwegian lobster, its host. The male attaches itself to a feeding stage that contains a developing female and impregnates her. She escapes from the feeding stage and attaches herself to the host. The larva develops within the female S. pandora She then dies and the larva escapes.

Key Reproductive Features: sexual ; asexual ; fertilization ; ovoviviparous

  • Funch, P., R. Kristensen. 14 December 1995. Cycliophora is a New Phylum with Affinites to Entoprocta and Ectoprocta. Nature, 378: 711-714.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Symbion pandora

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 101 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GGGTCTTTATTGGGTGAC---GATCAAATTTATAATGTCGTTATTACTGGTCATGGATTTATTATGATTTTCTTTTTTGTAATACCAATTTTAATTGGTGGGTTTGGTAATTTTTTAGTACCTCTTATACTCTTATCTCCAGATATGTGTTTTCCGCGTATAAATAACCTATCCTTTTGGCTTCTACCCCCTGCGTTATCTTTATTGTTATTATCTACTTTAGTTTCCACAGGTGCTGGTACTGGGTGAACAATTTATCCACCTTTATCT------TTTCAACATAGAGGAAGTTCTGTCGATTTAGCTATTTTTTCTATACATCTAGCAGGTGTTTCCTCATTATTAGGTGCTGTTAATTTTATTTCTACAATTCTCAATATACGAGTAGCAGGAATGCCTATATTTAAACTTCCCTTATTCGTGTGATCTGTTCTTATTACAGCTGTTCTATTATTGTTATCTTTACCTGTGTTTGCAGGTGCTATTACGATG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Symbion pandora

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 100
Specimens with Barcodes: 100
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Symbion pandora is not on vulnerable, threatened, or endangered status. In fact, large populations can be found on a single lobster.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Unknown at this time

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Unknown at this time

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Symbion pandora

Symbion pandora is a jug-shaped microscopic aquatic animal that dwells on the mouth-parts of Norway lobsters. The animals are less than ½ mm wide, with sac-like bodies, and three distinctly different forms in different parts of their three-stage life cycle.

Classification and naming[edit]

They are so unlike any known animal that its discovery by Danish scientists in 1995[1] led to the creation of a new phylum. The phylum Cycliophora, from the Greek for 'carrying a small wheel', was named after the creature's circular mouth.[2] Two other members of that phylum have since been discovered.

Symbion refers to the animal's symbiotic relationship with its lobster host while the specific epithet pandora refers to the part of the organism's life cycle that reminded Funch and Reinhardt of the mythical Pandora's box.

Physical description[edit]

Symbion pandora has a bilateral, sac-like body with no coelom. There are three basic life stages:

  • Asexual feeding stage – At this stage, S. pandora is neither male nor female. It has a length of 347 μm and a width of 113 μm. On the posterior end of the sac-like body is a stalk with an adhesive disc, which attaches itself to the host. On the anterior end is a ciliated funnel (mouth) and an anus.
  • Sexual stage
    • FemaleS. pandora is the same size as the male in this stage. It does, however, have a digestive system which collapses and reconstitutes itself as a larva.[1]
    • MaleS. pandora has a length of 84 μm and a width of 42 μm during this stage. It has no mouth or anus, which signifies the absence of a digestive system. It also has two reproductive organs.

Reproduction[edit]

Symbion pandora can reproduce both asexually by budding and sexually. In sexual reproduction the male attaches to a feeding stage and impregnates a budding female. The female then separates from the feeding stage and attaches herself to another host, where the larva in her develops. The female dies, and the larva escapes. The sexual reproductive cycle is triggered when the host crustacean molts its skin in order to grow.[3]

In popular culture[edit]

Symbion pandora has been referenced by noted humor columnist Dave Barry in an article to dissuade readers from eating lobster.[4]

References[edit]

  1. ^ a b P. Funch & R. M. Christensen (1995), "Cycliophora is a new phylum with affinities to Entoprocta and Ectoprocta", Nature 378 (6558): 711–714, doi:10.1038/378711a0. 
  2. ^ "Zoologger: The most bizarre life story on Earth?", NewScientist.com, 28 April 2010 
  3. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press 
  4. ^ "The lobster rebellion - Dave Barry - MiamiHerald.com". miamiherald.com. Retrieved 2014-01-25. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!