Overview

Distribution

depth in m: 0-400; horizontal distribution: Antarctic, circumpolar mainly south of Polar Front
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 337 specimens in 1 taxon.
Water temperature and chemistry ranges based on 325 samples.

Environmental ranges
  Depth range (m): 0 - 3111
  Temperature range (°C): -1.898 - 1.878
  Nitrate (umol/L): 22.800 - 35.684
  Salinity (PPS): 33.549 - 34.729
  Oxygen (ml/l): 3.766 - 8.084
  Phosphate (umol/l): 1.189 - 2.424
  Silicate (umol/l): 21.227 - 106.666

Graphical representation

Depth range (m): 0 - 3111

Temperature range (°C): -1.898 - 1.878

Nitrate (umol/L): 22.800 - 35.684

Salinity (PPS): 33.549 - 34.729

Oxygen (ml/l): 3.766 - 8.084

Phosphate (umol/l): 1.189 - 2.424

Silicate (umol/l): 21.227 - 106.666
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thysanoessa macrura

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATATTTCATTTTTGGTGCATGAGCTGGGATAGTAGGTACTTCACTAAGATTAATTATTCGAGCTGAATTGGGACAACCAGGTAGGTTAATTGGCGAT---GATCAAATTTATAATGTTGTAGTTACAGCACATGCTTTTGTTATAATTTTCTTTATGGTAATACCGATTATAATTGGGGGATTTGGTAATTGACTTGTACCTCTTATATTAGGAGCTCCGGACATAGCCTTTCCACGTATAAACAACATAAGGTTCTGGCTTTTACCTCCTTCTTTAACACTCTTATTAGGTAGTGGTCTTGTAGAAAGAGGTGTCGGTACAGGATGAACAGTTTACCCTCCATTATCAGCAGGTATTGCACATGCTGGTGCTTCAGTTGATATGGGTATCTTTTCTCTCCATATTGCTGGTGCTTCTTCTATTTTGGGAGCAGTAAATTTCATTACCACTGTTATTAACATGCGATCTGCTGGTATAACTATAGACCGTATTCCTTTATTTGTATGGTCTGTCTTTATTACAGCTATTTTACTTTTATTATCCCTACCAGTTTTAGCAGGAGCTATTACTATATTACTAACGGACCGTAATTTGAATACTTCTTTTTTTGATCCAGCGGGAGGGGGAGACCCTATTTTATACCAGCAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thysanoessa macrura

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!