Overview
Distribution
depth in m: 0-400; horizontal distribution: Antarctic, circumpolar mainly south of Polar Front
-
Kylin, H. (1956). Die Gattungen der Rhodophyceen. C.W.K. Gleerup: Lund, Sweden. xv, 673 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=24
-
Mauchline, J. and Fisher, L.R. (1969) The Biology of Euphausiids. Advances in Marine Biology 7: 1-454
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10060
-
Weigmann Haas, R. (1980) Geographische Verbreitung und vertikale Verbreitung der Euphausiacea (Crustacea) während der Antarktis- Expedition 1975/76. Meeresforschung, 28, 19-31
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=23009
-
Baker, A.de C. (1959) Distribution and life history of Euphausia triacantha Holt and Tattersall. Discovery Reports 129: 309-340
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10062
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Antarctic Ocean, New Zealand Exclusive Economic Zone
-
Siegel V, De Broyer C, Clarke A, Koubbi P, Pakhomov E, Scott F, Vanden Berghe W and Danis B (Editors). The SCAR-MarBIN Register of Antarctic Marine Species (RAMS): Euphausiacea, [date accessed]. World Wide Web electronic publication.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10068
-
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244
© WoRMS for SMEBD
Source:
World Register of Marine Species
Trusted
Ecology
Habitat
Depth range based on 337 specimens in 1 taxon.
Water temperature and chemistry ranges based on 325 samples.
Environmental ranges
Depth range (m): 0 - 3111
Temperature range (°C): -1.898 - 1.878
Nitrate (umol/L): 22.800 - 35.684
Salinity (PPS): 33.549 - 34.729
Oxygen (ml/l): 3.766 - 8.084
Phosphate (umol/l): 1.189 - 2.424
Silicate (umol/l): 21.227 - 106.666
Graphical representation
Depth range (m): 0 - 3111
Temperature range (°C): -1.898 - 1.878
Nitrate (umol/L): 22.800 - 35.684
Salinity (PPS): 33.549 - 34.729
Oxygen (ml/l): 3.766 - 8.084
Phosphate (umol/l): 1.189 - 2.424
Silicate (umol/l): 21.227 - 106.666
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 325 samples.
Environmental ranges
Depth range (m): 0 - 3111
Temperature range (°C): -1.898 - 1.878
Nitrate (umol/L): 22.800 - 35.684
Salinity (PPS): 33.549 - 34.729
Oxygen (ml/l): 3.766 - 8.084
Phosphate (umol/l): 1.189 - 2.424
Silicate (umol/l): 21.227 - 106.666
Graphical representation
Depth range (m): 0 - 3111
Temperature range (°C): -1.898 - 1.878
Nitrate (umol/L): 22.800 - 35.684
Salinity (PPS): 33.549 - 34.729
Oxygen (ml/l): 3.766 - 8.084
Phosphate (umol/l): 1.189 - 2.424
Silicate (umol/l): 21.227 - 106.666
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Thysanoessa macrura
The following is a representative barcode sequence, the centroid of all available sequences for this species.
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTATATTTCATTTTTGGTGCATGAGCTGGGATAGTAGGTACTTCACTAAGATTAATTATTCGAGCTGAATTGGGACAACCAGGTAGGTTAATTGGCGAT---GATCAAATTTATAATGTTGTAGTTACAGCACATGCTTTTGTTATAATTTTCTTTATGGTAATACCGATTATAATTGGGGGATTTGGTAATTGACTTGTACCTCTTATATTAGGAGCTCCGGACATAGCCTTTCCACGTATAAACAACATAAGGTTCTGGCTTTTACCTCCTTCTTTAACACTCTTATTAGGTAGTGGTCTTGTAGAAAGAGGTGTCGGTACAGGATGAACAGTTTACCCTCCATTATCAGCAGGTATTGCACATGCTGGTGCTTCAGTTGATATGGGTATCTTTTCTCTCCATATTGCTGGTGCTTCTTCTATTTTGGGAGCAGTAAATTTCATTACCACTGTTATTAACATGCGATCTGCTGGTATAACTATAGACCGTATTCCTTTATTTGTATGGTCTGTCTTTATTACAGCTATTTTACTTTTATTATCCCTACCAGTTTTAGCAGGAGCTATTACTATATTACTAACGGACCGTAATTTGAATACTTCTTTTTTTGATCCAGCGGGAGGGGGAGACCCTATTTTATACCAGCAT
-- end --
-- end --
Download FASTA File
© Barcode of Life Data Systems
Trusted
Statistics of barcoding coverage: Thysanoessa macrura
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
© Barcode of Life Data Systems
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
