Overview
Comprehensive Description
Transparent, yellowish if rich in lipids, females might develop blue hue when spawning; Eyes bi-lobed, rostrum pointed, photophores red; Anntennae lack lappet, carapace with denticle; Abdominal segments 3-6 terminate dorsally with spines; 6th abdominal segment shorter than the two preceding segments combined; second pair of thorathic legs elongated, but often broken during collection
Trusted
Distribution
Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, North East Pacific, North Pacific
-
Institute of Ocean Science Zooplankton Database
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=150286
-
Shih, C.T., A.J.G. Figueira & E.H. Grainger, 1971. A synopsis of Canadian marine zooplankton. Bull. Fish. Res. Bd Can. 176 : 1-264.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=31636
Trusted
depth in m: 140-280; horizontal distribution: boreal to subarctic N Pacific
-
Kylin, H. (1956). Die Gattungen der Rhodophyceen. C.W.K. Gleerup: Lund, Sweden. xv, 673 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=24
-
Brinton E (1962). The distribution of Pacific euphausiids. Bull. Scipps Inst. Oceanography, 8 (1): 51-269
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=22998
-
Mauchline J. (1980), The Biololgy of Mysids and Euphausiids. Advances in marine Biology (London), 18, 1-680
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=23005
Trusted
Ecology
Habitat
Depth range based on 66 specimens in 1 taxon.
Water temperature and chemistry ranges based on 55 samples.
Environmental ranges
Depth range (m): 0 - 549
Temperature range (°C): -0.183 - 12.204
Nitrate (umol/L): 2.538 - 27.783
Salinity (PPS): 31.271 - 33.778
Oxygen (ml/l): 2.991 - 7.600
Phosphate (umol/l): 0.663 - 2.317
Silicate (umol/l): 9.221 - 43.878
Graphical representation
Depth range (m): 0 - 549
Temperature range (°C): -0.183 - 12.204
Nitrate (umol/L): 2.538 - 27.783
Salinity (PPS): 31.271 - 33.778
Oxygen (ml/l): 2.991 - 7.600
Phosphate (umol/l): 0.663 - 2.317
Silicate (umol/l): 9.221 - 43.878
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 55 samples.
Environmental ranges
Depth range (m): 0 - 549
Temperature range (°C): -0.183 - 12.204
Nitrate (umol/L): 2.538 - 27.783
Salinity (PPS): 31.271 - 33.778
Oxygen (ml/l): 2.991 - 7.600
Phosphate (umol/l): 0.663 - 2.317
Silicate (umol/l): 9.221 - 43.878
Graphical representation
Depth range (m): 0 - 549
Temperature range (°C): -0.183 - 12.204
Nitrate (umol/L): 2.538 - 27.783
Salinity (PPS): 31.271 - 33.778
Oxygen (ml/l): 2.991 - 7.600
Phosphate (umol/l): 0.663 - 2.317
Silicate (umol/l): 9.221 - 43.878
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Subarctic Pacific in shelf-break habitats deeper than 200 m, amd some some isolated deep fjords; Transposted into the Chukchi Sea by currents; Undergo limited diel vertical migrations, spending daytime near bottom or typically 150-300 m (500 m maximum), night-time shallower
Trusted
Trophic Strategy
Primarily predatory on smaller zooplankton, but can consume algae when abundant; Prey item for fish, birds, seals and whales
Trusted
Life History and Behavior
Life Cycle
Females lay several clutches of eggs during spring; Females require repeated mating after each molt to form new egg clutches; Life cycles is typcial: eggs, nauplius, metanauplius, followed by several stages of feeding calytopsis, and furcillia larvae; Juveniles resemble adults, and molt regularly while growing to adulthood over the first year of life; Life expectancy not known, likely 2-3 years
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Thysanoessa longipes
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
TTATATTTTATTTTTGGTGCATGAGCTGGTATAGTAGGAACTTCATTAAGGCTTATTATTCGAGCTGAATTAGGACAACCAGGAAGTCTTATTGGAGAT---GATCAAATTTATAACGTAGTAGTTACAGCACATGCTTTTGTGATAATTTTTTTTATAGTAATGCCTATCATAATTGGAGGATTTGGTAATTGATTGGTTCCCCTTATATTAGGAGCCCCAGATATGGCATTTCCACGAATAAATAATATAAGATTTTGACTTCTTCCCCCTTCACTAACCTTATTATTAGGAAGAGGACTTGTAGAAAGAGGTGTAGGAACAGGATGAACAGTCTACCCTCCTTTGTCAGCAGGTATTGCACATGCTGGAGCTTCAGTTGATATAGGAATTTTTTCTCTGCATATTGCAGGTGCTTCTTCTATTTTAGGAGCTGTAAATTTCATTACTACAGTTATTAATATACGATCAGCTGGAATAACAATAGACCGAATCCCATTATTTGTATGATCAGTTTTTATTACGGCTATTTTACTTTTACTATCTCTGCCAGTTCTAGCTGGAGCTATTACGATACTTTTAACAGATCGTAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGACCCTATTTTATATCAGCATTTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Thysanoessa longipes
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!

