Overview

Comprehensive Description

Biology

A Pacific krill expatriated into the Arctic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Transparent, yellowish if rich in lipids, females might develop blue hue when spawning; Eyes bi-lobed, rostrum pointed, photophores red; Anntennae lack lappet, carapace with denticle; Abdominal segments 3-6 terminate dorsally with spines; 6th abdominal segment shorter than the two preceding segments combined; second pair of thorathic legs elongated, but often broken during collection
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

depth in m: 140-280; horizontal distribution: boreal to subarctic N Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 66 specimens in 1 taxon.
Water temperature and chemistry ranges based on 55 samples.

Environmental ranges
  Depth range (m): 0 - 549
  Temperature range (°C): -0.183 - 12.204
  Nitrate (umol/L): 2.538 - 27.783
  Salinity (PPS): 31.271 - 33.778
  Oxygen (ml/l): 2.991 - 7.600
  Phosphate (umol/l): 0.663 - 2.317
  Silicate (umol/l): 9.221 - 43.878

Graphical representation

Depth range (m): 0 - 549

Temperature range (°C): -0.183 - 12.204

Nitrate (umol/L): 2.538 - 27.783

Salinity (PPS): 31.271 - 33.778

Oxygen (ml/l): 2.991 - 7.600

Phosphate (umol/l): 0.663 - 2.317

Silicate (umol/l): 9.221 - 43.878
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Subarctic Pacific in shelf-break habitats deeper than 200 m, amd some some isolated deep fjords; Transposted into the Chukchi Sea by currents; Undergo limited diel vertical migrations, spending daytime near bottom or typically 150-300 m (500 m maximum), night-time shallower
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Primarily predatory on smaller zooplankton, but can consume algae when abundant; Prey item for fish, birds, seals and whales
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Females lay several clutches of eggs during spring; Females require repeated mating after each molt to form new egg clutches; Life cycles is typcial: eggs, nauplius, metanauplius, followed by several stages of feeding calytopsis, and furcillia larvae; Juveniles resemble adults, and molt regularly while growing to adulthood over the first year of life; Life expectancy not known, likely 2-3 years
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thysanoessa longipes

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATATTTTATTTTTGGTGCATGAGCTGGTATAGTAGGAACTTCATTAAGGCTTATTATTCGAGCTGAATTAGGACAACCAGGAAGTCTTATTGGAGAT---GATCAAATTTATAACGTAGTAGTTACAGCACATGCTTTTGTGATAATTTTTTTTATAGTAATGCCTATCATAATTGGAGGATTTGGTAATTGATTGGTTCCCCTTATATTAGGAGCCCCAGATATGGCATTTCCACGAATAAATAATATAAGATTTTGACTTCTTCCCCCTTCACTAACCTTATTATTAGGAAGAGGACTTGTAGAAAGAGGTGTAGGAACAGGATGAACAGTCTACCCTCCTTTGTCAGCAGGTATTGCACATGCTGGAGCTTCAGTTGATATAGGAATTTTTTCTCTGCATATTGCAGGTGCTTCTTCTATTTTAGGAGCTGTAAATTTCATTACTACAGTTATTAATATACGATCAGCTGGAATAACAATAGACCGAATCCCATTATTTGTATGATCAGTTTTTATTACGGCTATTTTACTTTTACTATCTCTGCCAGTTCTAGCTGGAGCTATTACGATACTTTTAACAGATCGTAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGACCCTATTTTATATCAGCATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thysanoessa longipes

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!