Overview
Distribution
south of 50 degrees North
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
depth in m: 0-600; horizontal distribution: sub-Antarctic,sub-tropical, bipolar; boreal and antiboreal zones
-
Kylin, H. (1956). Die Gattungen der Rhodophyceen. C.W.K. Gleerup: Lund, Sweden. xv, 673 pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=24
-
Boltovskoy D. (1999). South Atlantic Zooplankton. Backhuys Publishers, Leiden, 1706 pp. (1961). Geology of the Arctic. Proceedings of the first international Symposium on Arctic Geology, Calgary, 1960. Toronto University Press.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=21766
-
Brinton E (1962). The distribution of Pacific euphausiids. Bull. Scipps Inst. Oceanography, 8 (1): 51-269
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=22998
-
Ponomareva, L.A. (1963) The Euphausiids of the North Pacific, their Distribution and Ecology. Dokl. Acad. Nauk. SSSR. 1-142
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=23006
-
Mauchline, J. and Fisher, L.R. (1969) The Biology of Euphausiids. Advances in Marine Biology 7: 1-454
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10060
Trusted
European waters (ERMS scope), FAO fishing area 67, Gulf of Maine, Gulf of Mexico, Mediterranean Sea, New Zealand Exclusive Economic Zone, North East Pacific, North West Atlantic, South Africa (country), Subantarctic Waters
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Gibbons, M.J., M. Barange & L. Hutchings (1995). Zoogeography and diversity of euphausiids around southern Africa. Marine Biology 123: 257-268.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6179
-
Siegel V, De Broyer C, Clarke A, Koubbi P, Pakhomov E, Scott F, Vanden Berghe W and Danis B (Editors). The SCAR-MarBIN Register of Antarctic Marine Species (RAMS): Euphausiacea, [date accessed]. World Wide Web electronic publication.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=10068
-
Gordon, D. (Ed.) (2009). New Zealand Inventory of Biodiversity. Volume One: Kingdom Animalia. 584 pp
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145244
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
van der Land, J. (2001). Euphausiacea, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 284
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=1397
-
Johnson CL, Runge JA, Curtis KA, Durbin EG, Hare JA, Incze LS, Link J, Melvin GD, O'Brien TD, Van Guelpen, L (in revision) Biodiversity and ecosystem function in the Gulf of Maine: pattern and role of zooplankton and pelagic nekton. PLoS One.
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=148111
-
Institute of Ocean Science Zooplankton Database
http://www.marinespecies.org/copepoda/aphia.php?p=sourcedetails&id=150286
Trusted
Ecology
Habitat
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Mesopelagic
-
Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=145459
Trusted
Epipelagic
-
Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
http://www.vliz.be/vmdcdata/masdea/masdea.php?p=sourcedetails&id=145459
Trusted
pelagic species, found from surface to 1000 m
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 61 specimens in 1 taxon.
Water temperature and chemistry ranges based on 58 samples.
Environmental ranges
Depth range (m): 5 - 1375
Temperature range (°C): 4.560 - 21.351
Nitrate (umol/L): 0.052 - 33.273
Salinity (PPS): 34.418 - 36.936
Oxygen (ml/l): 1.958 - 5.630
Phosphate (umol/l): 0.055 - 2.111
Silicate (umol/l): 0.943 - 41.912
Graphical representation
Depth range (m): 5 - 1375
Temperature range (°C): 4.560 - 21.351
Nitrate (umol/L): 0.052 - 33.273
Salinity (PPS): 34.418 - 36.936
Oxygen (ml/l): 1.958 - 5.630
Phosphate (umol/l): 0.055 - 2.111
Silicate (umol/l): 0.943 - 41.912
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 58 samples.
Environmental ranges
Depth range (m): 5 - 1375
Temperature range (°C): 4.560 - 21.351
Nitrate (umol/L): 0.052 - 33.273
Salinity (PPS): 34.418 - 36.936
Oxygen (ml/l): 1.958 - 5.630
Phosphate (umol/l): 0.055 - 2.111
Silicate (umol/l): 0.943 - 41.912
Graphical representation
Depth range (m): 5 - 1375
Temperature range (°C): 4.560 - 21.351
Nitrate (umol/L): 0.052 - 33.273
Salinity (PPS): 34.418 - 36.936
Oxygen (ml/l): 1.958 - 5.630
Phosphate (umol/l): 0.055 - 2.111
Silicate (umol/l): 0.943 - 41.912
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Thysanoessa gregaria
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
TTATACTTCATTTTTGGTGCATGAGCTGGAATAGTAGGCACTTCTTTAAGATTAATTATTCGAGCTGAACTAGGTCAACCTGGGAGATTAATTGGAGAT---GATCAAATTTATAATGTTGTTGTTACAGCACATGCTTTTGTTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCCCTTATGCTTGGTGCACCTGATATAGCTTTTCCACGTATGAATAATATAAGGTTTTGACTTCTGCCACCTTCCTTAACTCTTTTACTAGGTAGAGGCCTTGTAGAGAGAGGAGTTGGCACAGGTTGAACTGTTTATCCTCCTTTATCTGCAGGCATCGCCCATGCTGGAGCTTCAGTGGATATAGGAATCTTTTCATTACATATTGCAGGAGCTTCATCTATTTTAGGTGCAGTAAATTTTATTACTACTGTAATTAATATACGATCTGCTGGAATAACTATAGACCGAATACCTTTATTTGTATGATCTGTATTTATTACAGCAATTTTACTTCTACTATCTTTACCAGTTTTAGCTGGGGCTATCACTATACTTTTAACAGACCGTAATCTGAATACTTCTTTTTTTGACCCAGCAGGAGGAGGAGACCCTATTTTATACCAACATCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Thysanoessa gregaria
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!
