Overview

Distribution

depth in m: 0-600; horizontal distribution: sub-Antarctic,sub-tropical, bipolar; boreal and antiboreal zones
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

south of 50 degrees North
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Mesopelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Epipelagic
  • Census of Marine Zooplankton, 2006. NOAA Ship Ronald H Brown, deployment RHB0603, Sargasso Sea. Peter Wiebe, PI. Identifications by L. Bercial, N. Copley, A. Cornils, L. Devi, H. Hansen, R. Hopcroft, M. Kuriyama, H. Matsuura, D. Lindsay, L. Madin, F. Pagè
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

pelagic species, found from surface to 1000 m
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 61 specimens in 1 taxon.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): 5 - 1375
  Temperature range (°C): 4.560 - 21.351
  Nitrate (umol/L): 0.052 - 33.273
  Salinity (PPS): 34.418 - 36.936
  Oxygen (ml/l): 1.958 - 5.630
  Phosphate (umol/l): 0.055 - 2.111
  Silicate (umol/l): 0.943 - 41.912

Graphical representation

Depth range (m): 5 - 1375

Temperature range (°C): 4.560 - 21.351

Nitrate (umol/L): 0.052 - 33.273

Salinity (PPS): 34.418 - 36.936

Oxygen (ml/l): 1.958 - 5.630

Phosphate (umol/l): 0.055 - 2.111

Silicate (umol/l): 0.943 - 41.912
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thysanoessa gregaria

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATACTTCATTTTTGGTGCATGAGCTGGAATAGTAGGCACTTCTTTAAGATTAATTATTCGAGCTGAACTAGGTCAACCTGGGAGATTAATTGGAGAT---GATCAAATTTATAATGTTGTTGTTACAGCACATGCTTTTGTTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCCCTTATGCTTGGTGCACCTGATATAGCTTTTCCACGTATGAATAATATAAGGTTTTGACTTCTGCCACCTTCCTTAACTCTTTTACTAGGTAGAGGCCTTGTAGAGAGAGGAGTTGGCACAGGTTGAACTGTTTATCCTCCTTTATCTGCAGGCATCGCCCATGCTGGAGCTTCAGTGGATATAGGAATCTTTTCATTACATATTGCAGGAGCTTCATCTATTTTAGGTGCAGTAAATTTTATTACTACTGTAATTAATATACGATCTGCTGGAATAACTATAGACCGAATACCTTTATTTGTATGATCTGTATTTATTACAGCAATTTTACTTCTACTATCTTTACCAGTTTTAGCTGGGGCTATCACTATACTTTTAACAGACCGTAATCTGAATACTTCTTTTTTTGACCCAGCAGGAGGAGGAGACCCTATTTTATACCAACATCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Thysanoessa gregaria

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!