Overview

Distribution

depth in m: 0-250; horizontal distribution: North and equatorial Pacific, not venturing more than 200 Miles east of the American Continent
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Type Information

Type for Nyctiphanes simplex Hansen
Catalog Number: USNM 45349
Collection: Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology
Sex/Stage: male; female;
Preparation: Alcohol (Ethanol)
Year Collected: 1905
Locality: Espanola Island, W Point, Galapagos Islands, Ecuador, South Pacific Ocean
Depth (m): 549
Vessel: Albatross R/V
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Invertebrate Zoology

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 549 - 549
  Temperature range (°C): 8.246 - 8.246
  Nitrate (umol/L): 38.777 - 38.777
  Salinity (PPS): 34.649 - 34.649
  Oxygen (ml/l): 0.655 - 0.655
  Phosphate (umol/l): 2.881 - 2.881
  Silicate (umol/l): 46.874 - 46.874
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nyctiphanes simplex

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTATATTTTATTTTCGGAGCGTGAGCTGGAATAGTTGGGACTTCTTTAAGACTAATTATTCGAGCAGAGCTAGGACAACCGGGTAGATTGATTGGAGAT---GATCAAATTTATAACGTAGTTGTTACAGCACATGCTTTCGTAATGATTTTTTTCATGGTAATACCTATTATAATTGGAGGATTTGGAAACTGACTAGTCCCTCTTATATTAGGAGCTCCAGATATAGCATTTCCACGAATGAATAACATAAGATTCTGACTTCTTCCTCCTTCACTAACACTACTACTAGGTAGAGGTTTAGTTGAAAGAGGAGTTGGAACAGGCTGAACAGTTTACCCTCCTTTATCAGCGGGAATTGCTCACGCAGGAGCATCTGTAGATATAGGAATTTTTTCATTACATATTGCAGGAGCTTCATCAATCTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAGCAGGTATAACTATAGACCGTATCCCTTTATTTGTATGATCAGTATTTATTACAGCGATTCTATTACTCTTATCTCTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAACCTAAATACTTCATTCTTCGATCCTGCTGGAGGGGGAGATCCTATTTTATATCAACACTTATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nyctiphanes simplex

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!