Overview

Comprehensive Description

Biology

A large, subarctic Atlantic krill, maringally present in the Arctic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Transparent, yellowish if rich in lipids, females might develop blue hue when spawning; Eyes round, rostrum absent, photophores red; Small post-ocular spines (one above each eye); Anntennae with backward pointing leaflet, carapace with denticle; Abdominal segments without spines on keel
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Boreal Atlantic species; can be carried into Arctic waters, but does not reproduce there.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

depth in m: 100-400; horizontal distribution: boreal and arctic Atlantic, Mediterranean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to Cape Hatteras
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The first segment of the stalk of the antennules carries a large lobar process, which nearly reaches the eyes. The carapace is armed with a spine behind each eye; the lateral corners of the carapace are transformed into short sharp points. The endopodite of the uropods is very narrow, almost the same length as the telson. The exopodite is somewhat longer and almost 2 times wider than the endopodite. The lobar processes on the endopodites of the pleopods of males have a characteristic shape (shown on figure).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length up to 50 mm.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Elizaveta A. Ershova

Source: iArcZoo

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 325 specimens in 1 taxon.
Water temperature and chemistry ranges based on 299 samples.

Environmental ranges
  Depth range (m): 4 - 3200
  Temperature range (°C): 0.545 - 12.863
  Nitrate (umol/L): 3.925 - 23.955
  Salinity (PPS): 32.565 - 35.965
  Oxygen (ml/l): 3.466 - 6.732
  Phosphate (umol/l): 0.382 - 1.571
  Silicate (umol/l): 2.068 - 32.176

Graphical representation

Depth range (m): 4 - 3200

Temperature range (°C): 0.545 - 12.863

Nitrate (umol/L): 3.925 - 23.955

Salinity (PPS): 32.565 - 35.965

Oxygen (ml/l): 3.466 - 6.732

Phosphate (umol/l): 0.382 - 1.571

Silicate (umol/l): 2.068 - 32.176
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subarctic Atlantic in shelf-break habitats deeper than 200 m, amd some some isolated deep fjords; Transposted into the Chukchi Sea by currents; Undergo diel vertical migrations, spending daytime at 100-400 m (with records to 1500 m), night-time 0-100 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Floating in open sea, found at depths of 0-500 m .
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Primarily predatory on smaller zooplankton, but can consume algae when abundant; Prey item for fish, squid, decapods, whales, seals, and seabirds
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Females lay several clutches of eggs (brood size 350-550) during spring; Females require repeated mating after each molt to form new egg clutches; Life cycles is typcial: eggs, nauplius, metanauplius, followed by several stages of feeding calytopsis, and furcillia larvae; Juveniles resemble adults, and molt regularly while growing to adulthood over the first year of life; Life expectancy not known, likely 1-2 years
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Meganyctiphanes norvegica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 33
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Meganyctiphanes norvegica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 12 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCGCATATCGGAATAGTTGGAACTTCTTTAAGACTTATTATTCGAGCAGAACTAGGTCAACCAGGTAGGTTGATTGGAGAT---GATCAAATTTATAATGTAGTTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAACTGGTTAGTTCCGCTTATATTAGGAGCACCTGATATAGCATTTCCACGAATGAATAACATAAGATTTTGATTATTACCACCTTCTTTAACTCTTTTATTAGGCAGAGGTCTTGTAGAAAGAGGAGTCGGCACTGGATGAACAGTTTATCCACCTTTATCAGCTGGAATTGCTCACGCAGGAGCCTCAGTTGACATAGGAATTTTTTCACTACATATTGCAGGAGCTTCTTCTATTTTGGGAGCTGTAAACTTTATTACAACTGTAATTAATATACGATCAGCAGGGATAACTATAGACCGAATTCCATTATTTGTGTGATCAGTATTTATTACAGCAATTTTACTTTTATTATCACTTCCAGTTTTAGCAGGAGCTATTACTATACTTCTAACAGATCGTAATCTTAACACATCATTTTTTGACCCTGCTGGTGGTGGAGATCCAATTCTATATCAACATCTATTTTGATTTTTTGGTCACCCTGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern krill

Northern krill, Meganyctiphanes norvegica, is a species of krill that lives in the North Atlantic Ocean. It is an important component of the zooplankton, providing food for whales, fish and birds. (In the Southern Ocean, Antarctic krill Euphausia superba fills a similar role.) M. norvegica is the only species recognised in the genus Meganyctiphanes,[1] although it has been known by several synonyms:

  • Euphausia intermedia
  • Euphausia lanei Holt & Tattersall, 1905
  • Meganyctiphanes calmani
  • Nyctiphanes norvegicus G. O. Sars, 1883
  • Thysanopoda norvegica

References

  1. ^ Volker Siegel (2011). "Meganyctiphanes Holt & Tattersall, 1905". In Volker Siegel. World Euphausiacea database. World Register of Marine Species. http://www.marinespecies.org/aphia.php?p=taxdetails&id=110674. Retrieved February 26, 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!