Overview

Brief Summary

Euphausia superba is a species of krill found in the Antarctic waters of the Southern Ocean. This species is the primary food source for many larger marine organisms and is a key species in the ecosystem. It is a shrimp-like crustacean that lives in large schools and feeds directly on minute phytoplankton, thereby using the primary production energy that the phytoplankton originally derived from the sun in order to sustain their pelagic life cycle. In terms of biomass, currently the most abundant species on Earth.

  • Volker Siegel (2010). "Euphausia superba Dana, 1850". In Volker Siegel. World Euphausiacea database. World Register of Marine Species. Retrieved May 10, 2011.
  • William M. Hamner, Peggy P. Hamner, Steven W. Strand & Ronald W. Gilmer (1983). "Behavior of Antarctic krill, Euphausia superba: chemoreception, feeding, schooling and molting". Science 220 (4595): 433–435. Bibcode 1983Sci...220..433H. doi:10.1126/science.220.4595.433. PMID 17831417.
  • Uwe Kils & Norbert Klages (1979). "Der Krill [Krill]" (in German). Naturwissenschaftliche Rundschau 10: 397–402.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Catherine Sutera

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

depth in m: in summer usually 0 - 200 m, in winter down to 350 m; sometimes recorded as deep as 600 m; horizontal distribution: Antarctic, circumpolar south of Polar Front
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Antarctic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

E. superba is found principally bellow of 60°S and close to the ice-edge (McLeod et al., 2010)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth range based on 389 specimens in 1 taxon.
Water temperature and chemistry ranges based on 362 samples.

Environmental ranges
  Depth range (m): 0 - 955
  Temperature range (°C): -1.901 - 1.343
  Nitrate (umol/L): 21.839 - 35.828
  Salinity (PPS): 33.401 - 34.713
  Oxygen (ml/l): 3.991 - 8.086
  Phosphate (umol/l): 1.189 - 2.404
  Silicate (umol/l): 21.227 - 106.493

Graphical representation

Depth range (m): 0 - 955

Temperature range (°C): -1.901 - 1.343

Nitrate (umol/L): 21.839 - 35.828

Salinity (PPS): 33.401 - 34.713

Oxygen (ml/l): 3.991 - 8.086

Phosphate (umol/l): 1.189 - 2.404

Silicate (umol/l): 21.227 - 106.493
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 600 - 600
  Temperature range (°C): -0.291 - -0.291
  Nitrate (umol/L): 31.026 - 31.026
  Salinity (PPS): 34.564 - 34.564
  Oxygen (ml/l): 5.319 - 5.319
  Phosphate (umol/l): 1.928 - 1.928
  Silicate (umol/l): 92.729 - 92.729
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Euphausia superba, is a keystone species in the ecosystem of the Southern ocean. It is the principal phytoplankton consumer. Both food and predators are most abundant at the surface, thus krill during the day go to the depth of the ocean and return to the upper layers at night, to feed at a time when the predatory risk is lowest (Gaten et al., 2008). The analysis of the gut contents showed that during winter, krill could prey upon meso- and microzooplankton (Perissinotto et al. 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

  • G. A. Knox, Antarctic marine ecosystems. In: Antarctic Ecology, M. W. Holdgate, Ed. (Academic Press, New York, 1970) 1:69-96, from p. 87.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Euphausia superba preys on:
microalgae
phytoplankton

Based on studies in:
Antarctic (Estuarine)

This list may not be complete but is based on published studies.
  • G. A. Knox, Antarctic marine ecosystems. In: Antarctic Ecology, M. W. Holdgate, Ed. (Academic Press, New York, 1970) 1:69-96, from p. 87.
  • N. A. Mackintosh, A survey of antarctic biology up to 1945. In: Biologie antarctique, R. Carrick, M. Holdgate, J. Prevost, Eds. (Hermann, Paris, 1964), pp. 3-38.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The krill constitutes the main food item of many higher predators such as seals, whales, fishes and penguins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

The Antarctic krill E. superba plays a key role in the Antarctic food web. The populations of the diverse high consumers depend on the krill availability. Abundance and biomass of the E. superba present wide seasonal and inter-annual fluctuations linked to the food availability (principally unicellular algae) and to the physical environment (Siegel, 2005 and Nicol, 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Growth

Ikeda (1985), from experimental data of growth, reported a fast growth up to the adult stage (35 mm body length), which then slow down towards full size (60 mm body length). The growth rate obtained using the equation RNA-growth rate of Båmstedt & Skjoldad (1980) resulted 0.17 -0.19 mm day-1 for specimens greater than 30 mm body length (Ikeda, 1989).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Genetics

The genetic analysis on the euphausiids from the Antarctic and sub-Antarctic regions showed a large genetic divergence between the Antarctic species E. superba and E. crystallorophias, and the sub-Antarctic one, E. vallentini. The separation occurred around 20 million years ago, which is comparable with the geological time of the formation of the circum-Antarctic water circulation and the Antarctic Polar Frontal Zone (Patarnello et al., 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Euphausia superba

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 548 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CAGCGTTGGCTATTCTCAACTAATCACAAAGACATTGGTACATTATACTTTATTTTCGGTGCATGAGCTGGAATAGTAGGTACTTCACTAAGATTGATTATTCGAGCTGAGTTAGGACAACCAGGTAGTTTAATTGGAGAT---GACCAAATTTATAATGTTGTAGTTACAGCACATGCTTTTGTTATAATCTTCTTTATGGTAATACCAATTATGATTGGTGGGTTTGGTAACTGGCTTGTTCCACTAATGCTAGGAGCCCCTGATATGGCATTCCCACGAATAAACAACATAAGATTTTGATTACTACCCCCTTCCTTAACTCTCTTATTAGGAAGAGGTTTAGTAGAAAGTGGGGTTGGTACTGGGTGAACAGTATATCCACCTTTATCAGCAGGAATTGCTCATGCTGGAGCCTCTGTTGATATAGGAATCTTCTCGCTTCATATTGCCGGTGCTTCTTCAATTTTAGGAGCCGTAAACTTTATTACAACTGTAATTAATATACGATCAGCAGGTATAACTATAGACCGTATTCCATTATTTGTATGATCAGTGTTTATTACAGCTATCCTACTTCTCCTCTCTCTCCCGGTTCTAGCTGGAGCAATTACTATACTTCTTACAGATCGTAATTTAAATACCTCATTCTTCGACCCAGCCGGTGGTGGTGACCCTATTCTCTACCAACATTTATTTTGGTTTTTTGGACACCCAGAGGTCTATATTCTTATTTTACCTGCATTCGGTATAATCTCCCATATTATTAGACAAGAATCAGGTAAAAAACAAGCATTCGGTACACTAGGTATAATTTATGCTATAATGGCAATTGGTGTTCTTGGATTTGTAGTATGAGCTCACCATATATTTACAGTAGGGATAGACGTAGATACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Euphausia superba

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 490
Specimens with Barcodes: 493
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Research Collection of Slava Ivanenko
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The control of the population size of krill has been related to predation (Marr, 1962; Laws, 1985; Murphy, 1995; Reid & Croxall, 2001) and to food resources within winter sea ice (Quetin et al., 1996; Siegel, 2000). Atkinson et al. (2004), analyzing the data of the stock and the span from 1926 to 2003, showed a direct link between annual krill density an sea-ice cover. This factor seems to be a dominant role not only in krill recruitment (Quetin et al., 1996; Siegel, 2000), but also in the population size (Atkinson et al., 2004). The link found with summer density of krill by Atkinson et al. (2004) was with ice cover the preceding winter. This lag period suggest the larval over-wintering as a key process affected by ice, larvae must be survive their first winter to recruit the following summer (Atkinson et al., 2004) and they need to double in length (Quetin et al., 1996) . Sufficient winter ice in the major spawning and nursery areas (the Antarctic Peninsula and Southern Scotia Arc, Marr, 1962; Quetin et al., 1996; Siegel, 2000; Hofmann & Hüsrevo?lu, 2003) affects krill density across a whole ocean basin. But the western Antarctic Peninsula is fastest warming area, and the winter sea ice duration is shortening (Parkinson, 2002). So the krill spawning and nursery areas are situated in region sensitive to environmental changes (Atkinson et al., 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

The fishing activities of E. superba are controlled by the Convention for the Conservation of the Antarctic Marine Living Resource (CCAMLR).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Stefano Schiaparelli

Partner Web Site: Census of Antarctic Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Antarctic krill

Antarctic krill, Euphausia superba, is a species of krill found in the Antarctic waters of the Southern Ocean. It is a small, swimming crustacean that lives in large schools, called swarms, sometimes reaching densities of 10,000–30,000 individual animals per cubic metre.[2] It feeds directly on minute phytoplankton, thereby using the primary production energy that the phytoplankton originally derived from the sun in order to sustain their pelagic (open ocean) life cycle.[3] It grows to a length of 6 centimetres (2.4 in), weighs up to 2 grams (0.071 oz), and can live for up to six years. It is a key species in the Antarctic ecosystem and is, in terms of biomass, probably the most abundant animal species on the planet (approximately 500 million tonnes).[4]

Contents

Life cycle

The eggs are spawned close to the surface and start sinking. In the open ocean they sink for about 10 days: the nauplii hatch at around 3,000 metres (9,800 ft) depth

The main spawning season of Antarctic krill is from January to March, both above the continental shelf and also in the upper region of deep sea oceanic areas. In the typical way of all krill, the male attaches a spermatophore to the genital opening of the female. For this purpose, the first pleopods (legs attached to the abdomen) of the male are constructed as mating tools. Females lay 6,000–10,000 eggs at one time. They are fertilised as they pass out of the genital opening.[5]

According to the classical hypothesis of Marriosis De' Abrtona,[6] derived from the results of the expedition of the famous British research vessel RRS Discovery, egg development then proceeds as follows: gastrulation (development of egg into embryo) sets in during the descent of the 0.6 mm (0.024 in) eggs on the shelf at the bottom, in oceanic areas in depths around 2,000–3,000 metres (6,600–9,800 ft). The egg hatches as a nauplius larva; once this has moulted into a metanauplius, the young animal starts migrating towards the surface in a migration known as developmental ascent.[7]

The next two larval stages, termed second nauplius and metanauplius, still do not eat but are nourished by the remaining yolk. After three weeks, the young krill has finished the ascent. They can appear in enormous numbers counting 2 per litre in 60 m (200 ft) water depth. Growing larger, additional larval stages follow (second and third calyptopis, first to sixth furcilia). They are characterised by increasing development of the additional legs, the compound eyes and the setae (bristles). At 15 mm (0.59 in), the juvenile krill resembles the habitus of the adults. Krill reach maturity after two to three years. Like all crustaceans, krill must moult in order to grow. Approximately every 13 to 20 days, krill shed their chitinous exoskeleton and leave it behind as exuvia.

The head of Antarctic krill. Observe the bioluminescent organ at the eyestalk and the nerves visible in the antennae, the gastric mill, the filtering net at the thoracopods and the rakes at the tips of the thoracopods.

Food

The gut of E. superba can often be seen shining green through the animal's transparent skin, an indication that this species feeds predominantly on phytoplankton – especially very small diatoms (20 μm), which it filters from the water with a feeding basket.[8] The glass-like shells of the diatoms are cracked in the "gastric mill" and then digested in the hepatopancreas. The krill can also catch and eat copepods, amphipods and other small zooplankton. The gut forms a straight tube; its digestive efficiency is not very high and therefore a lot of carbon is still present in the feces.

In aquaria, krill have been observed to eat each other. When they are not fed in aquaria, they shrink in size after moulting, which is exceptional for animals the size of krill. It is likely that this is an adaptation to the seasonality of their food supply, which is limited in the dark winter months under the ice. However, the animal's compound eyes do not shrink, and so the ratio between eye size and body length has thus been found to be a reliable indicator of starvation.[9]

Filter feeding

Antarctic krill directly use the minute phytoplankton cells, which no other animal of krill size can do. This is accomplished through filter feeding, using the krill's highly developed front legs, providing for an efficient filtering apparatus:[10] the six thoracopods (legs attached to the thorax) form a very effective "feeding basket" used to collect phytoplankton from the open water. In the finest areas the openings in this basket are only 1 μm in diameter. In lower food concentrations, the feeding basket is pushed through the water for over half a metre in an opened position, and then the algae are combed to the mouth opening with special setae (bristles) on the inner side of the thoracopods.

Antarctic krill feeding on ice algae. The surface of the ice on the left side is coloured green by the algae.

Ice-algae raking

Antarctic krill can scrape off the green lawn of ice-algae from the underside of the pack ice.[11][12] Krill have developed special rows of rake-like setae at the tips of the thoracopods, and graze the ice in a zig-zag fashion. One krill can clear an area of a square foot in about 10 minutes (1.5 cm2/s). It is relatively new knowledge that the film of ice algae is very well developed over vast areas, often containing much more carbon than the whole water column below. Krill find an extensive energy source here, especially in the spring.

Biological pump and carbon sequestration

In situ image taken with an ecoSCOPE. A green spit ball is visible in the lower right of the image and a green fecal string in the lower left.

Krill are thought to undergo between one and three vertical migrations from mixed surface waters to depth each day.[13] The krill is a very untidy feeder, and it often spits out aggregates of phytoplankton (spit balls) containing thousands of cells sticking together. It also produces fecal strings that still contain significant amounts of carbon and the glass shells of the diatoms. Both are heavy and sink very fast into the abyss. This process is called the biological pump. As the waters around Antarctica are very deep (2,000–4,000 metres or 6,600–13,000 feet), they act as a carbon dioxide sink: this process exports large quantities of carbon (fixed carbon dioxide, CO2) from the biosphere and sequesters it for about 1,000 years.

If the phytoplankton is consumed by other components of the pelagic ecosystem, most of the carbon remains in the upper strata. There is speculation that this process is one of the largest biofeedback mechanisms of the planet, maybe the most sizable of all, driven by a gigantic biomass. Still more research is needed to quantify the Southern Ocean ecosystem.

Biology

Bioluminescence

Watercolour of bioluminescent krill

Krill are often referred to as light-shrimp because they can emit light, produced by bioluminescent organs. These organs are located on various parts of the individual krill's body: one pair of organs at the eyestalk (cf. the image of the head above), another pair on the hips of the second and seventh thoracopods, and singular organs on the four pleonsternites. These light organs emit a yellow-green light periodically, for up to 2–3 s. They are considered so highly developed that they can be compared with a torchlight: a concave reflector in the back of the organ and a lens in the front guide the light produced, and the whole organ can be rotated by muscles. The function of these lights is not yet fully understood; some hypotheses have suggested they serve to compensate the krill's shadow so that they are not visible to predators from below; other speculations maintain that they play a significant role in mating or schooling at night.

The krill's bioluminescent organs contain several fluorescent substances. The major component has a maximum fluorescence at an excitation of 355 nm and emission of 510 nm.[14]

Lobstering krill

Escape reaction

Krill use an escape reaction to evade predators, swimming backwards very quickly by flipping their rear ends. This swimming pattern is also known as lobstering. Krill can reach speeds of over 0.6 metres per second (2.0 ft/s).[15] The trigger time to optical stimulus is, despite the low temperatures, only 55 ms.

Geographical distribution

Krill distribution on a NASA SeaWIFS image  – the main concentrations are in the Scotia Sea at the Antarctic Peninsula

Antarctic krill has a circumpolar distribution, being found throughout the Southern Ocean, and as far north as the Antarctic Convergence.[16] Isolated populations of larvae may occasionally be carried much further north, with records from as far north as Isla Guarello in Chile, at 50° south.[16] At the Antarctic Convergence, the cold Antarctic surface water submerges below the warmer subantarctic waters. This front runs roughly at 55° south; from there to the continent, the Southern Ocean covers 32 million square kilometres. This is 65 times the size of the North Sea. In the winter season, more than three-quarters of this area become covered by ice, whereas 24,000,000 square kilometres (9,300,000 sq mi) become ice free in summer. The water temperature fluctuates at −1.3–3 °C (30–37 °F).

The waters of the Southern Ocean form a system of currents. Whenever there is a West Wind Drift, the surface strata travels around Antarctica in an easterly direction. Near the continent, the East Wind Drift runs counterclockwise. At the front between both, large eddies develop, for example, in the Weddell Sea. The krill schools drift with these water masses, to establish one single stock all around Antarctica, with gene exchange over the whole area. Currently, there is little knowledge of the precise migration patterns since individual krill cannot yet be tagged to track their movements.

Ecology

Antarctic krill is the keystone species of the Antarctica ecosystem, and provides an important food source for whales, seals, Leopard Seals, fur seals, Crabeater Seals, squid, icefish, penguins, albatrosses and many other species of birds. Crabeater seals have even developed special teeth as an adaptation to catch this abundant food source: its unusual multilobed teeth enable this species to sieve krill from the water. Its dentition looks like a perfect strainer, but how it operates in detail is still unknown. Crabeaters are the most abundant seal in the world; 98% of their diet is made up of E. superba. These seals consume over 63 million tonnes of krill each year.[17] Leopard seals have developed similar teeth (45% krill in diet). All seals consume 63–130 million tonnes, all whales 34–43 million tonnes, birds 15–20 million tonnes, squid 30–100 million tonnes, and fish 10–20 million tonnes, adding up to 152–313 million tonnes of krill consumption each year.[18]

The size step between krill and its prey is unusually large: generally it takes three or four steps from the 20 μm small phytoplankton cells to a krill-sized organism (via small copepods, large copepods, mysids to 5 cm fish).[3] The next size step in the food chain to the whales is also enormous, a phenomenon only found in the Antarctic ecosystem. E. superba lives only in the Southern Ocean. In the North Atlantic, Meganyctiphanes norvegica and in the Pacific, Euphausia pacifica are the dominant species.

Biomass and production

The biomass of Antarctic krill is estimated to be 125 to 725 million tonnes.[19] The reason Antarctic krill are able to build up such a high biomass and production is that the waters around the icy Antarctic continent harbour one of the largest plankton assemblages in the world, possibly the largest. The ocean is filled with phytoplankton; as the water rises from the depths to the light-flooded surface, it brings nutrients from all of the world's oceans back into the photic zone where they are once again available to living organisms.

Thus primary production – the conversion of sunlight into organic biomass, the foundation of the food chain – has an annual carbon fixation of 1–2 g/m2 in the open ocean. Close to the ice it can reach 30–50 g/m2. These values are not outstandingly high, compared to very productive areas like the North Sea or upwelling regions, but the area over which it takes place is enormous, even compared to other large primary producers such as rainforests. In addition, during the Austral summer there are many hours of daylight to fuel the process. All of these factors make the plankton and the krill a critical part of the planet's ecocycle.

Decline with shrinking pack ice

Temperature and pack ice area over time, after data compiled by Loeb et al. 1997.[20] The scale for the ice is inverted to demonstrate the correlation; the horizontal line is the freezing point – the oblique line the average of the temperature.

A possible decline in Antarctic krill biomass may have been caused by the reduction of the pack ice zone due to global warming.[21] Antarctic krill, especially in the early stages of development, seem to need the pack ice structures in order to have a fair chance of survival. The pack ice provides natural cave-like features which the krill uses to evade their predators. In the years of low pack ice conditions the krill tend to give way to salps,[22] a barrel-shaped free-floating filter feeder that also grazes on plankton.

Ocean acidification

Another challenge for Antarctic krill, as well as many calcifying organisms (corals, bivalve mussels, snails etc.), is the Acidification of the oceans caused by increasing levels of carbon dioxide.[23] Krill exoskeleton contains carbonate, which is susceptible to dissolution under low pH conditions. It has already been shown that increased carbon dioxide can disrupt the development of krill eggs and even prevent the juvenile krill from hatching.[24] The further effects of ocean acidification on the krill life cycle however remains unclear but scientists fear that it could significantly impact on its distribution, abundance and survival.[25][26]

Fisheries

Annual world catch of E. superba, compiled from FAO data.[19]

The fishery of Antarctic krill is on the order of 100,000 tonnes per year. The major catching nations are South Korea, Norway, Japan and Poland.[27] The products are used as animal food and fish bait. Krill fisheries are difficult to operate in two important respects. First, a krill net needs to have very fine meshes, producing a very high drag, which generates a bow wave that deflects the krill to the sides. Second, fine meshes tend to clog very fast.

Yet another problem is bringing the krill catch on board. When the full net is hauled out of the water, the organisms compress each other, resulting in great loss of the krill's liquids. Experiments have been carried out to pump krill, while still in water, through a large tube on board. Special krill nets also are currently under development. The processing of the krill must be very rapid since the catch deteriorates within several hours. Its high protein and vitamin content makes krill quite suitable for both direct human consumption and the animal-feed industry.[28]

Future visions and ocean engineering

Despite the lack of knowledge available about the whole Antarctic ecosystem, large scale experiments involving krill are already being performed to increase carbon sequestration: in vast areas of the Southern Ocean there are plenty of nutrients, but still, the phytoplankton does not grow much. These areas are termed HNLC (high nutrient, low chlorophyll). The phenomenon is called the Antarctic Paradox, and occurs because iron is missing.[29] Relatively small injections of iron from research vessels trigger very large blooms, covering many miles. The hope is that such large scale exercises will draw down carbon dioxide as compensation for the burning of fossil fuels.[30]

References

  1. ^ Volker Siegel (2010). "Euphausia superba Dana, 1850". In Volker Siegel. World Euphausiacea database. World Register of Marine Species. Archived from the original on 24 May 2011. Retrieved May 10, 2011. 
  2. ^ William M. Hamner, Peggy P. Hamner, Steven W. Strand & Ronald W. Gilmer (1983). "Behavior of Antarctic krill, Euphausia superba: chemoreception, feeding, schooling and molting". Science 220 (4595): 433–435. Bibcode:1983Sci...220..433H. doi:10.1126/science.220.4595.433. PMID 17831417. 
  3. ^ a b Uwe Kils & Norbert Klages (1979). "Der Krill" [The Krill]. Naturwissenschaftliche Rundschau (in German) 32 (10): 397–402. 
  4. ^ Stephen Nicol & Yoshinari Endo (1997). Krill Fisheries of the World. Fisheries Technical Paper 367. Food and Agriculture Organization. ISBN 92-5-104012-5. 
  5. ^ Robin M. Ross & Langdon B. Quetin (1986). "How productive are Antarctic krill?". BioScience 36 (4): 264–269. doi:10.2307/1310217. JSTOR 1310217. 
  6. ^ James William Slessor Marr (1962). The natural history and geography of the Antarctic krill (Euphausia superba Dana). "Discovery" Reports 32. pp. 33–464. 
  7. ^ Irmtraut Hempel & Gotthilf Hempel (1986). "Field observations on the developmental ascent of larval Euphausia superba (Crustacea)". Polar Biology 6 (2): 121–126. doi:10.1007/BF00258263. 
  8. ^ Uwe Kils. "Antarctic krill Euphausia superba filter of thoracopods". Ecoscope.com. 
  9. ^ Hyoung-Chul Shin & Stephen Nicol (2002). "Using the relationship between eye diameter and body length to detect the effects of long-term starvation on Antarctic krill Euphausia superba". Marine Ecology Progress Series 239: 157–167. doi:10.3354/meps239157. 
  10. ^ Uwe Kils (1983). Swimming and feeding of Antarctic krill, Euphausia superba - some outstanding energetics and dynamics - some unique morphological details. In S. B. Schnack. "On the biology of krill Euphausia superba". Proceedings of the Seminar and Report of Krill Ecology Group (Alfred Wegener Institute for Polar and Marine Research). Special Issue 4: 130–155. 
  11. ^ Peter Marschall & Uwe Kils. "Antarctic krill Euphausia superba in ice cave". Ecoscope.com. 
  12. ^ Hans-Peter Marschall (1988). "The overwintering strategy of Antarctic krill under the pack ice of the Weddell Sea". Polar Biology 9 (2): 129–135. doi:10.1007/BF00442041. 
  13. ^ Geraint A. Tarling & Magnus L. Johnson (2006). "Satiation gives krill that sinking feeling". Current Biology 16 (3): 83–84. doi:10.1016/j.cub.2006.01.044. PMID 16461267. 
  14. ^ H. Rodger Harvey & Se-Jong Ju (10–12 December 2001). "Biochemical determination of age structure and diet history of the Antarctic krill, Euphausia superba, during austral winter". Third U.S. Southern Ocean GLOBEC Science Investigator Meeting. Arlington. http://www.ccpo.odu.edu/Research/globec/3sciinvest/harvey.htm.
  15. ^ Uwe Kils (1982). Swimming behaviour, swimming performance and energy balance of Antarctic krill Euphausia superba. BIOMASS Scientific Series 3. pp. 1–122. 
  16. ^ a b "Euphausia superba". Euphausiids of the World Ocean. Marine Species Identification Portal. Retrieved May 20, 2011. 
  17. ^ B. Bonner (1995). "Birds and Mammals – Antarctic Seals". In R. Buckley. Antarctica. Pergamon Press. pp. 202–222. ISBN 0-08-028881-2. 
  18. ^ D. G. M. Miller & I. Hampton (1989). Biology and ecology of the Antarctic krill (Euphausia superba Dana): a review. BIOMASS Scientific Series 9. Scientific Committee on Antarctic Research. pp. 1–66. ISBN 0-948277-09-2. 
  19. ^ a b "Species Fact Sheet Euphausia superba". Food and Agriculture Organization. Retrieved June 16, 2005. 
  20. ^ V. Loeb, V. Siegel, O. Holm-Hansen, R. Hewitt, W. Fraser, W. Trivelpiece & S. Trivelpiece (1997). "Effects of sea-ice extent and krill or salp dominance on the Antarctic food web" (PDF). Nature 387 (6636): 897–900. Bibcode:1997Natur.387..897L. doi:10.1038/43174. 
  21. ^ Liza Gross (2005). "As the Antarctic ice pack recedes, a fragile ecosystem hangs in the balance". PLoS Biology 3 (4): e127. doi:10.1371/journal.pbio.0030127. PMC 1074811. PMID 15819605. 
  22. ^ Angus Atkinson, Volker Siegel, Evgeny Pakhomov & Peter Rothery (2004). "Long-term decline in krill stock and increase in salps within the Southern Ocean". Nature 432 (7013): 100–103. Bibcode:2004Natur.432..100A. doi:10.1038/nature02996. PMID 15525989. 
  23. ^ Australian Antarctic Climate & Ecosystems, Cooperative Research Centre (2008). Position analysis: CO2 emissions and climate change: OCEAN impacts and adaptation issues. ISSN 1835-7911. 
  24. ^ So Kawaguchi, Haruko Kurihara, Robert King, Lillian Hale, Thomas Berli, James P. Robinson, Akio Ishida, Masahide Wakita, Patti Virtue, Stephen Nicol & Atsushi Ishimatsu (2011). "Will krill fare well under Southern Ocean acidification?" (PDF). Biology Letters 7 (2): 288–291. doi:10.1098/rsbl.2010.0777. 
  25. ^ Jill Rowbotham (September 24, 2008). "Swiss marine researcher moving in for the krill". The Australian. 
  26. ^ James C. Orr, Victoria J. Fabry, Olivier Aumont, Laurent Bopp, Scott C. Doney et al. (2005). "Anthropogenic ocean acidification over the twenty-first century and its impact on calcifying organisms". Nature 437 (7059): 681–686. Bibcode:2005Natur.437..681O. doi:10.1038/nature04095. PMID 16193043. 
  27. ^ CCAMLR Statistical Bulletin vol. 20 (1998-2007), CCAMLR, Hobart, Australia, 2008. URL last accessed July 3, 2008.
  28. ^ Inigo Everson, David J. Agnew & Denzil G. M. Miller (2000). "Krill fisheries and the future". In Inigo Everson. Krill: Biology, Ecology and Fisheries. Fish and aquatic resources series. Oxford: Blackwell Science. pp. 345–348. ISBN 978-0-632-05565-4. 
  29. ^ Caroline Dopyera (October 1996). "The Iron Hypothesis". 
  30. ^ Ben Matthews (November 1996). "Climate Engineering. A critical review of proposals, their scientific and political context, and possible impacts". 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!