Overview

Distribution

Canadian Exclusive Economic Zone [Pacific part], FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

depth in m: 0-1000; horizontal distribution: widespread in boreal north Pacific waters
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 279 specimens in 1 taxon.
Water temperature and chemistry ranges based on 256 samples.

Environmental ranges
  Depth range (m): 0 - 4023
  Temperature range (°C): 1.494 - 13.115
  Nitrate (umol/L): 2.538 - 40.662
  Salinity (PPS): 31.271 - 34.681
  Oxygen (ml/l): 0.737 - 8.585
  Phosphate (umol/l): 0.663 - 3.032
  Silicate (umol/l): 6.430 - 175.641

Graphical representation

Depth range (m): 0 - 4023

Temperature range (°C): 1.494 - 13.115

Nitrate (umol/L): 2.538 - 40.662

Salinity (PPS): 31.271 - 34.681

Oxygen (ml/l): 0.737 - 8.585

Phosphate (umol/l): 0.663 - 3.032

Silicate (umol/l): 6.430 - 175.641
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Euphausia pacifica (Euphausia similis, E. pacifica) preys on:
detritus
phytoplankton

Based on studies in:
Japan (Brackish water, epipelagic zone)

This list may not be complete but is based on published studies.
  • K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Euphausia pacifica (Euphausia similis, E. pacifica) is prey of:
Sergia lucens
Diaphus coeruleus
Diaphus elucens
Todarodes pacificus

Based on studies in:
Japan (Brackish water, epipelagic zone)

This list may not be complete but is based on published studies.
  • K. Hogetsu, Biological productivity of some coastal regions of Japan. In: Marine Production Mechanisms, M. J. Dunbar, Ed. (International Biological Programme Series, no. 20, Cambridge Univ. Press, Cambridge, England, 1979), pp. 71-87, from p. 74.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Euphausia pacifica

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACGCAGCAGCGTTGGCTATTCTCAACTAATCACAAAGACATCGGCACTCTATACTTTATTTTTGGTGCATGAGCAGGAATAGTAGGTACTTCTCTAAGATTAATTATTCGAGCTGAGTTAGGACAACCAGGTAGATTAATTGGAGACGACCAAATCTATAATGTTGTAGTAACAGCCCATGCTTTTGTTATAATTTTTTTTATGGTAATACCAATCATAATTGGAGGATTTGGAAACTGACTTGTTCCTCTTATATTAGGTGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGGTTTTGGCTTTTACCCCCTTCATTAACTCTTTTATTAGGTAGAGGCCTGGTAGAAAGTGGAGTGGGGACAGGTTGAACGGTATACCCTCCTTTATCTGCAGGAATTGCACATGCTGGAGCTTCTGTAGATATAGGAATCTTTTCACTACATATTGCTGGAGCTTCTTCTATTTTAGGAGCAGTTAATTTCATTACAACTGTAATTAATATACGATCAGCAGGAATAACTATAGACCGTATCCCACTATTCGTATGGTCTGTGTTTATTACAGCAATTTTACTTTTATTATCTCTACCAGTTTTAGCTGGAGCAATCACAATACTTTTAACAGACCGTAATTTGAATACATCTTTCTTCGACCCTGCCGGAGGTGGTGACCCTATTTTATATCAACATCTATTCTGATTTTTTGGGCATCCCGAAGTTTATATTTTAATTTTACCAGCCTTTGGAATAATTTCTCATATTATTAGACAAGAGTCAGGTAAAAAACAAGCATTTGGTACTTTAGGTATAATTTATGCTATGATAGCAATTGGTGTCCTAGGATTTGTAGTTTGAGCTCACCATATGTTTACAGTAGGAATAGACGTAGATACACGAGCTTACTTTACATCAGCAACTATAATCATTGCTGTACCAACAGGAATTAAAATTTTTAGATGATTAGGTACTTTACATGGTGCTCAACTTAATTATTCACCTTCCTTAATTTGAGCTTTAGGCTTTGTTTTCTTATTCACAGTTGGAGGTCTGACAGGTGTTGTTCTAGCAAATTCTTCAATTGATGTTGTCCTACATGATACTTATTATGTAGTTGCCCATTTCCACTATGTTTTATCTATAGGAGCTGTATTCGGCATTTTTGCTGGTATTGCGCACTGATTTCCTTTATTTACAGGCTTAACTATAAACCCTAAATGATTAAAACTCCACTTTTTAGTTATATTTACTGGTGTGAATATTACTTTCTTCCCACAACACTTTTTAGGTTTAAATGGTATACCACGGCGATATTCAGACTATCCAGATGCTTATACCCCATGAAATGTTTTATCATCGATTGGGTCAACTATTTCACTAATCGCCGTTTTAGGGTTTATACTTATTGTATGAGAAGCTCTAGTAAGAGCACGTCCTGTTCTTTTCTCTTTATTTTTACCGACTTCTTTAGAGTGAGAACACAACCTACCGCCTGCAGACCATAGTTATATAGAAATCCCTATAATTGCAGCTTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Euphausia pacifica

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Euphausia pacifica

Euphausia pacifica, the North Pacific krill, is a euphausid that lives in the northern Pacific Ocean.[2]

In Japan, E. pacifica is called isada krill or tsunonashi okiami (ツノナシオキアミ). It is found from Suruga Bay northwards, including all of the Sea of Japan and the south-western part of the Sea of Okhotsk. E. pacifica is fished from Cape Inubo north.[2] The annual catch of krill in Japanese seas is limited to 70,000 metric tonnes by government regulations. E. pacifica is also fished, albeit on a smaller scale, in the waters of British Columbia, Canada.[2]

E. pacifica is a major food item for various fish, including Pacific cod, Alaska pollock, chub mackerel, sand lance, North Pacific hake, Pacific herring, dogfish, sablefish, Pacific halibut, chinook salmon and coho salmon.[2]

Gills


References

  1. ^ "Euphausia pacifica Hansen, 1911". Integrated Taxonomic Information System. 
  2. ^ a b c d Stephen Nicol & Yoshinari Endo (1997). "North Pacific krill". Krill fisheries of the world. Volume 367 of FAO fisheries technical paper. Food and Agriculture Organization. pp. 17–30. ISBN 978-92-5-104012-6. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!